Search results


Species: Taenia solium
Id: Scaffold02122.gene10974
Length: 504
Strand: -
Start: 437
Stop: 1991
Annotation: K05327 IPR015925 Q8TA74
Function: Ryanodine receptor-related
Scaffold: Scaffold02122
Sequence:
>Scaffold02122.gene10974
ATGGGCGTTAACGTAACCAACTTTCGCCTGTTTCAGCTCGTGTTGGCGGTCATGTTGACTTCAGTTGTGATCTACCTTTGCACTGTCATCGTATTCAACTTCTTCCGCAAATTCCTCACCGAAGTGGAGGATGGAGAGAAGGAATACAAGTGCATTGACATGTTGAGTTGTTTCGTCTTCCACCTCCACATGGGTCTGCGAGCGGGTGGTGGAATTGGAGATGAGATTGAACCACCCGATGGAGACGCACATGAAGCGCTACGGATCCTCTTTGACATGTCATTCTTCTTCTTTGTCATTGTCACCCTCCTTGCGATCCTTCAAGGTCTCATCATCGACGCCTTTGGCGACCTGCGAGATCAGTTAGAGCAGGTGAGGGAGGACTTGGAGTCCAAGTGTTTCATCTGTGGTATCGGGGAGGAGTACTCTGATGCCATTCTACATGGCTCGATCGACACGTGGAACGCGAACACAACTTCATCAGCTACATGTAAGTTCATTTGA

>Scaffold02122.gene10974
MGVNVTNFRLFQLVLAVMLTSVVIYLCTVIVFNFFRKFLTEVEDGEKEYKCIDMLSCFVFHLHMGLRAGGGIGDEIEPPDGDAHEALRILFDMSFFFFVIVTLLAILQGLIIDAFGDLRDQLEQVREDLESKCFICGIGEEYSDAILHGSIDTWNANTTSSATCKFI*