Search results


Species: Taenia solium
Id: Scaffold00892.gene10485
Length: 555
Strand: +
Start: 7602
Stop: 9372
Annotation: K05327 IPR005821|IPR015925 GO:0005216|GO:0006811|GO:0016020|GO:0055085 C4QI05
Function: Ion transport|Ryanodine receptor-related
Scaffold: Scaffold00892
Sequence:
>Scaffold00892.gene10485
ATGGAACAAAGACTGGCAGAAACAACGGAGGTAGCAGTGGAATTACTTCGAGTGGACACCCCGAGGAGGTCTCGAACAGCTGGTTCTATTCAACGTGGCTTCTGGAGATGGATGTGCAATACCTGCTTTGGAAGTGGGGTGTCATCTTCACGGATAAATCTACTTTACTGTCCTGTGGCCCACCGTCGTTACCCTCTTTCATGCCACCTGCTGGATGTGGCTATTTCATTCAAAACACTGGCCACCATTGTACAATCGGTTACACACAACGGAAAACAGCTCGTGTTGATGGTCATGTTGACTTCAGTTGTGATCTACCCTTACACTGTCGTTGCATTCAACTTCTTCCGCAAATTCTACACCAAAGAGGAGGATGGAGAGAAAGAATACAAGTGTGATGACATGTTGACTTGTTTCGTCTTCCACCTCCACACGAGTCTGCGAGCGGGTGAAGTTGGAGATGAGATTGAACCACCCGATGGAAATGCACATGAAGCGCTACTGATCCTCTTTGCATGTCATTCTTCTTCTTTGTCATCACCACCCTCCTTTTGA

>Scaffold00892.gene10485
MEQRLAETTEVAVELLRVDTPRRSRTAGSIQRGFWRWMCNTCFGSGVSSSRINLLYCPVAHRRYPLSCHLLDVAISFKTLATIVQSVTHNGKQLVLMVMLTSVVIYPYTVVAFNFFRKFYTKEEDGEKEYKCDDMLTCFVFHLHTSLRAGEVGDEIEPPDGNAHEALLILFACHSSSLSSPPSF*