Search results


Species: Taenia solium
Id: Scaffold00256.gene8831
Length: 3000
Strand: +
Start: 41752
Stop: 53485
Annotation: K08893 IPR008266|IPR001245|IPR011009 GO:0016772|GO:0004672|GO:0006468|GO:0004713 C4PYY1
Function: Tyrosine-protein kinase, active site|Serine-threonine/tyrosine-protein kinase|Protein kinase-like domain
Scaffold: Scaffold00256
Sequence:
>Scaffold00256.gene8831
ATGAAGCATCCAGTTGCCGACGACTGCACACTGACAATACCCTGCACTCGAGAAAAGCCCCAAACACCGTTCCATGAGGCAGAAATAAGTCGCGAATCGGTGCAAATGATTCGCATCATTGATAAAAGGAGCTTTGGTGAAGTGTGGTTTGGCCGAATCCAGAGTGTTGAGGTGGCCGTAAAGATCCCGTTGACCACGGCATGTCGGGAGGATATTATTCGAGAGGCGAAGAAAATGCACGCTATTTGGCATGCCCAGTTGGTGCAATTCCTTGGTGTCTGCGCAAAACCACCCGAAGAATCGGTTCTTGTAATTACAGAGTATATGTCCAATGGGGCGTTGAATAAGTGCCTTCAGACAGAGGAAGGAAGGACTTTGAAACAGACCGATCTACTCTCAATAATGGATCAGGTAGCAAACGGTATGGTCTACTTAGAATCCATTCAATTTGTGCATCGTGATCTCCGAGCTGCTAATGTTTTTGTGGCGAAAGACGGTCGAGTCAAGGTGGGGGACGTTGGGCAATCAAAAATGCTCTCCATGCCTTCATCCAACCCTACAGATCTCCAAACACCTATTCGCTGGTCGTCGCCAGAGGCGCTGACAAATGAGAAAGAAGTCACCTCCAAAAGTGACTTCTGGCAGTACGGTGTTTTGGGCTATGAAGTCTTCTCTTACGGTGGTGTACCCTATGAAGGGTACACAACAGAGGAGGCCATAAGAGCGATTCGCAGTGGTGAGACCCTCGACCTACCGGAGGAATGTACATGGAGAATGTATGAATTGATGCAATTGTGTTGGCGGCATGGGCCCGAGAATAGACCAAGCTTTAAGGAAATAGAGACAAAGGAAAATGAAGGTGATGCAGGACTAGAAGAGAAGGTAAAGGAGGACGTGAAATTGGGAAATTTTTGGCTACTTCAAAAGCAATATGCATCACAAGAAAGAGAGCTGTTGCAACTTCGCGAGACGTTGCGCCAACGGGACTCCTGGTGTGCTGAGACGGAAGCGGAGGTGGTGCGGTTGAGAAGTGCGTTGATCGCCTCGGAAAAGGCACGCAGCCGTCAGTCCGCCCTGCTGTCGCGTAGTCTGGTCGACAGAGAAGTGATTGCCTCCGAGGCCAGAGCCTGTGAGCGAGAGCTTTCAGAGGTGGAGGCCAAGATCCACCATCTTACCGCTGAGATACTAACCAGAGAATCACGTATTGTCCAGCTCGAAGACGAAGTAGCAGGACGTCGAGAGGTGGAGGCAAAAGTTAGCCAGATGACCGTGGCTTTTGAGGAGGCACTGCGCGAGCAAGCGGAGCAGCTACGCGCCCAATTTCTCTCTGAGAATGAGGAAGCTACTGTAGACAAAATAGGCTGTCTGGAGCAAGAAATTGAAAACCTGAAGGCCTCGCACTCTGAAGCGATGGATATCGTTACCAAACGGGAGGAAGCAAAAGCACGGACGGATGCTTACACCATCCACCAATTACAGCATAGAATAACGCAACTACAAGCTCAGTCGGAGTTACAAAGACAAGAAATAGATGACCTAAAGATGAGCAACAACAGACTCAAAGCAGATTTAGAGCATCTCGAGCGCTTTAGTCAGTCAATGAAAGTACGAGTTGAGGAGACGGAAGTCAAAGTTGTCCGAGAGCGAGTAAAAACGGACCAATTAGAGGCAGAATTGGTTGCCTGTCGCGGTGAACTAGTCTCCTCTGAACGGAACCTGCATGACCTCGCTTTGGAACAGGAAGTAGGACGAGAGCGGATTGCTGCTTCGGATAGGCGTTTCGAGACGATGCATGCACAGATAGTAGAACTTAACGCTTCCCTTCAGGCCTCTGCTCAGCAAAATGTCCTGCTTGAGGCCAAGGTGAAAGAAAGCGAGCAAACAAATGAGGCGCTAGAGCGAAGGCTCGATCAAGCCGAGAAGGAAGCGAAGAAGGCGTGCGATTGGATGCGGCACCTAGAGGAAGAGAATGTAGCCTTGATGACTACGAATCAGCAGCTGAAGAGCACAGTTAACGAGATGCGTTCTAGTTGCACCAACTTGCAATGCCAAAGAGAGAGTTCTAACTTAGAGATTGCGGAGCTAAAGGGCTTGCTAAACAAATTCGAGATGGAGAGAGAAGCCAATGAAGCCACGTTGAGCGAAAATCTCAGAATGGTTGGGATCCCCCTCCCCAACTGCCCAGAGACCTGCATTAGTGAAAGTGGGGAAGCATTAAATCATCCGACCTCTGAGTACATGCAAAGGCGTCGAGTGCTAGATGTTGCCGAGGCGGCAATGCTGTTTACCGGCAGAATTGCCGCTGTAGAGGCAGAAAACGCCCGTCTGGGTGATCAGCTAGCAACTCAGGAGGCGCATCTAGCGGAACAGCGCGTCCGGACTGACAGTCTCAATAACAATCTCCTCCAGCTGGAAGCACATCTTCGTAGTGCCAGAGAGGATAACAGGCGACTCAGCCTCCAGCAGGTCTCACTGAGGAGACAACTTGAGAACCAGAAGTGCTTTGCCACCAAATATCGTGAAGAAAAGCACGTGCTGCAGGAGAAGCTGGCCAGATGCGACCAACTTCTCAAATGCTCAGCTTGCCTTAACTCATTTTCAAATCCTGACAAGTTTTATAGTCACAAAGAGGTCGAGATGTTTATCAGGTTGGCGACTCTCTCCGAGAAGGCCAAGGGCTTGTCAAAAGTTCGAGATGATCAAAACGAAGCTAACCGGAGTATCACGGAGCCCGCTGAGATGGGTGTCGAACTTCAGGACACAAAGAGTTCGAGAACTGAGAAGAGCGTCTTCCCTCCTTCCTCTGTCTCCTCGGCCAAAATAGCCAAGGTGGCCTCGACTATAATGGCGGAATGTGTGGACAAAGAGGGCCGTTTCTGTACTGACACATTCCAAGCCCATCTGCGCAAGGCACTAGATATTCCACAGCAAACGACGAAACTTCATCGCTTAAGTCACAAAGGAGGATGCCTTAACAAAGCACTTCTTTCGCTCATCTAG

>Scaffold00256.gene8831
MKHPVADDCTLTIPCTREKPQTPFHEAEISRESVQMIRIIDKRSFGEVWFGRIQSVEVAVKIPLTTACREDIIREAKKMHAIWHAQLVQFLGVCAKPPEESVLVITEYMSNGALNKCLQTEEGRTLKQTDLLSIMDQVANGMVYLESIQFVHRDLRAANVFVAKDGRVKVGDVGQSKMLSMPSSNPTDLQTPIRWSSPEALTNEKEVTSKSDFWQYGVLGYEVFSYGGVPYEGYTTEEAIRAIRSGETLDLPEECTWRMYELMQLCWRHGPENRPSFKEIETKENEGDAGLEEKVKEDVKLGNFWLLQKQYASQERELLQLRETLRQRDSWCAETEAEVVRLRSALIASEKARSRQSALLSRSLVDREVIASEARACERELSEVEAKIHHLTAEILTRESRIVQLEDEVAGRREVEAKVSQMTVAFEEALREQAEQLRAQFLSENEEATVDKIGCLEQEIENLKASHSEAMDIVTKREEAKARTDAYTIHQLQHRITQLQAQSELQRQEIDDLKMSNNRLKADLEHLERFSQSMKVRVEETEVKVVRERVKTDQLEAELVACRGELVSSERNLHDLALEQEVGRERIAASDRRFETMHAQIVELNASLQASAQQNVLLEAKVKESEQTNEALERRLDQAEKEAKKACDWMRHLEEENVALMTTNQQLKSTVNEMRSSCTNLQCQRESSNLEIAELKGLLNKFEMEREANEATLSENLRMVGIPLPNCPETCISESGEALNHPTSEYMQRRRVLDVAEAAMLFTGRIAAVEAENARLGDQLATQEAHLAEQRVRTDSLNNNLLQLEAHLRSAREDNRRLSLQQVSLRRQLENQKCFATKYREEKHVLQEKLARCDQLLKCSACLNSFSNPDKFYSHKEVEMFIRLATLSEKAKGLSKVRDDQNEANRSITEPAEMGVELQDTKSSRTEKSVFPPSSVSSAKIAKVASTIMAECVDKEGRFCTDTFQAHLRKALDIPQQTTKLHRLSHKGGCLNKALLSLI*