Search results


Species: Taenia solium
Id: Scaffold00215.gene8346
Length: 1227
Strand: +
Start: 115451
Stop: 124463
Annotation: K01082 IPR020550|IPR000760 GO:0004437 Q5DAP1
Function: Inositol monophosphatase, conserved site|Inositol monophosphatase
Scaffold: Scaffold00215
Sequence:
>Scaffold00215.gene8346
ATGCGCAACCCCTCGCCCAACAGACCGCCCCAGACAGAAGCATGCACCGACGTACACTGTTTTCGGTGTTTTCTGAATAGGCGCCATCAGCCAATCGGAATCCTAATGGTACAGATTTCTCTAACGCACAAGGGTGTCTTTGTTCTGGTCGTTGGAGGCCTTGCTCTCCTTCTTTTTCTACTCTCTGATGGTGGCCAAACAAGCTATGAGACCAATCCCGATGTTATTAGTCTTCGGTCAATTTTTGTAACCTTAGTGATGGCTGTGGAAGAGGCTGGTCGTGCCATCAAGGCTATGCATGATCTCCAATCGTCAACACCATTCAACTTACATAAGAAGCCTGCTCTGCTTGTGTTGAATCCCACAGGACATGTGACAATGGAGGAAGTAGTAACAGAAGCTGATCTACTCTCCAACTACTGCATTATTAGACGCATCAAACTACTTCGACCGGATTTTATCTCGCAGATCAACTCAGAGGAGCGCGAGATGCCCCAGCAGTCATCAATAACACTGGCCTTGAAGACCATTCTCATGGGAGCACAATCTTTCGCAAGGCGCAAACAGGTGCTTGCTATGCTGCCGGAACAGGACGTCTTCCTACACCTGCGCCAAGTCTCTCTCTGGGTTGATCCTCTGGATGCCACGCAAGAGTATAGTGAAAATCTGCTCAAATTCGTTTCAGTAATGGGCTGTGGATCTATACACGGCGAACCCGTTTTCGGTGTTGTTCACTTCCCCTTCCTTAATACCACCTATTGGTCTTCTTTGGGCAATCATCTCTCGGAAAACCTGCGGCACATTCCCAAAGCTGAAGACCACATTCTGTCCCCATCGAATCCGCTGCGAATTCTCGTCTCTCGATCGCACAGCTTAGGCAACTTCAGTGGGAGGCTAAGAAAAGCTTTCGGTTCCACGCCAATTGAAATCATTCCAGCTGGTGGTTCAGGGTACAAGATGATTGAACTGGCACGTGGTGCAGCGGATCTCTATGTGCATGCAGGGGGGGCACGAAGGTGGGACATGTGCGCGCCTTCGGCCATCCTGCAGGCGCGCGGTGGAGTGGTACGCACCCTGGCGGGTGACACTCTCCACTTTCATCACAACGATCCCAGCGACCTTGACTCCCGCCAGGGCATCTTTGCAGCCGCTTCGCGCGACCTCTACAACACTTGGGCATCTACCGTCGCCTCGCTCATCTCTGATATCCCTTCCACTAAGACTTAA

>Scaffold00215.gene8346
MRNPSPNRPPQTEACTDVHCFRCFLNRRHQPIGILMVQISLTHKGVFVLVVGGLALLLFLLSDGGQTSYETNPDVISLRSIFVTLVMAVEEAGRAIKAMHDLQSSTPFNLHKKPALLVLNPTGHVTMEEVVTEADLLSNYCIIRRIKLLRPDFISQINSEEREMPQQSSITLALKTILMGAQSFARRKQVLAMLPEQDVFLHLRQVSLWVDPLDATQEYSENLLKFVSVMGCGSIHGEPVFGVVHFPFLNTTYWSSLGNHLSENLRHIPKAEDHILSPSNPLRILVSRSHSLGNFSGRLRKAFGSTPIEIIPAGGSGYKMIELARGAADLYVHAGGARRWDMCAPSAILQARGGVVRTLAGDTLHFHHNDPSDLDSRQGIFAAASRDLYNTWASTVASLISDIPSTKT*