Search results


Species: Taenia solium
Id: Scaffold00162.gene7465
Length: 2265
Strand: +
Start: 8751
Stop: 17720
Annotation: K04727 IPR016156|IPR013027|IPR023753 GO:0016491|GO:0055114|GO:0050660 C4Q4Z2
Function: FAD/NAD-linked reductase, dimerisation|FAD-dependent pyridine nucleotide-disulphide oxidoreductase|Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain
Scaffold: Scaffold00162
Sequence:
>Scaffold00162.gene7465
ATGGAAAACTACTTCCACTGGGGTCCCGTGACTAATCAATCCATTCAAGTAAGTTGGGATCAGGAAATCCCGGTGGAAGCAAGCGGTATGATAGTCACATTGACGGCAGAGATGGCTTCCAAGCCCAGTGTGGAAAGATCGGAGTCTGCACGCTTCAGTGTAGGAAGGATCACTGTTGACGGACTGATGCCCGACACACTATATATTGCGACATTGAAAGTATTGAAAGATGGACGGCAATTCCTCACTTCCACCAGAGACATTCGAACACTGAAAACTGCCGCGTTTGACAAGGCTCTGCGTGATGGTATGGCGCATTTACTGGCAAAGAGCGTTAGGAATCAAATCCATCCCGTATATGAAAAGAGGCCTCCAACCACGCCCAATAGATCTAACCCAAACTTGGCAGAGCCTCCCGCAGATGTTCCTTCGTCAACAAAATCCGCTCGACTACCTCCACGAGTGAAGCACGTAATCATTGGTGCAGGTGCCGCGGGTATCAACGCCGCCCGAGCCATTCGTTCGGTAGATCCCCTCGCTCTGGTCCTCCTCATCGCTGGCGACACGAACTGTGGAGAGGAGGAGGTAGAGACAGAGGAAGGAAAGACCTACCCTCCCCCGTACATTCGCCCTGTTCTCAGTGGTGGACTGTGGTGGCGTACACCGGAGAGACGCCAAGTTATGCTGGATCCACTGGGAGATATTCGCAGCCACTCTTGGTTCTACTATGAACCGCTTAGTTTCTTCATTGAGCCTCAAAAAATACCAGAAGCCGAGGAGGGTGGCATCTGCCTCCTTCGTGGGAATCCCGTTGTTGCCTTACATCCGAAGCGTCATGCGATCACTTTGGCCGACGGCCAGGAGATTCAATATGAATGCTGCCTTCTGGCCACTGGCGCTCGACCTCGTACCATACCAGAGCTGGGTCACTGCTCACACAGTGGTGCTGATCTCGTTGCTAACAAGCGTGTCACATACTTCCGCAACATCGCTGATTACAAGCACCTCCAAAGCGTCTCAGATCGGCTCCACAAGAACGGTGGCCGAGTAGCCGTTCTTGGATCCAATCAGCTAGCTTGTGAATTGGCGACAAGTTTCCTAGAAGAGCGTCGTCTCGCCAAGGAGGAGCAGGAAGCCAACCCACCAAAAGATTCTGCAGCATTCCATGTTCATCAGTTCCTCGGTTTCGGTGCCTTACATCCCATGGAAGACGTGTTGCCTCCAGTTCTTGCTCAAGCCGTTTCTGAATACGAAACTGCACGGGGTGTGGTGTTGTCTCCCTCGGCCACTATTGTTCGCGCTTCTCTAGTGGATCCAACCAACCCTGCTGAGTCTCGCATTCGTTTAACCATCCACAAACGGGAGGAAGGAGGGCTTATTAAGGAGGAGGAGGATTTAATCGTCGATCATGTTGTTTGTGTTGTTGGAGATGAGCCTCGGACGGAACTGGGTACTAAAGCTGGTCTTGAACTGGATCAGGTAAACGGGGGCTTACTGGTGAATAGCGAACTTGAGTCCCGGGACAATATCTACGCTGCTGGATCCGTGGCATCGTACTGGGACTCCGAGTTGGACTGTCGCCGACGTGTCGATCATATCAGCGCTTCGGAGGATACTGGAGAGCTGGCCGGTCTTAACATGGCTCGGAATGCTTCATCTTCGTCTCCCAAAGTGAAGGATAAGCTGGCGGAAGCGTGTGTTGCCCCTGAAAAAACTTATGATCCTCTGCCCTTCTCCCGCAAGCATCAAACTGCACTCTGGTTTAACATTGGTAAAGGTGCTCACTACGATTGCGTCGGATTGGTCGATTCGAAACATCTCATCACCCGAACTGTCTTTCTGGAAGGCGAGGAGTCCTCTGCCGTGGTGTTCTACCTTCGTCCAGAGGATAATCGACTAATGGGAGTATTGCTATGGAACATAACTGACGAGTTGTTCAAAGATCCTGAATACGCGGCTCCGAGTAGGCTTAATTTGGCACGGAGTTTGGTGGCGGATCGCTTGATCTTGCGTGAGGATGACGAAGTGCTGAAATGCGCCAGACAATTCGATTTAGGTGGTGAGATAGCAGAGCACTATGAGGAGTTGAAGACCTTCATTGAGGCGAAGAGAGCTGAAGACGAGGCAGCGACAGCGGCAGCAGCAGAAGCAATAGCGCTTGTGGAGAAGAAGGCAGAGACAACGGGGATTAATTCACAATTCTCGGTCAAGACCGAAACCGACGCAGTTGTGGTGCCGGCACCTAATAATAGTAGCGCTGTGTAG

>Scaffold00162.gene7465
MENYFHWGPVTNQSIQVSWDQEIPVEASGMIVTLTAEMASKPSVERSESARFSVGRITVDGLMPDTLYIATLKVLKDGRQFLTSTRDIRTLKTAAFDKALRDGMAHLLAKSVRNQIHPVYEKRPPTTPNRSNPNLAEPPADVPSSTKSARLPPRVKHVIIGAGAAGINAARAIRSVDPLALVLLIAGDTNCGEEEVETEEGKTYPPPYIRPVLSGGLWWRTPERRQVMLDPLGDIRSHSWFYYEPLSFFIEPQKIPEAEEGGICLLRGNPVVALHPKRHAITLADGQEIQYECCLLATGARPRTIPELGHCSHSGADLVANKRVTYFRNIADYKHLQSVSDRLHKNGGRVAVLGSNQLACELATSFLEERRLAKEEQEANPPKDSAAFHVHQFLGFGALHPMEDVLPPVLAQAVSEYETARGVVLSPSATIVRASLVDPTNPAESRIRLTIHKREEGGLIKEEEDLIVDHVVCVVGDEPRTELGTKAGLELDQVNGGLLVNSELESRDNIYAAGSVASYWDSELDCRRRVDHISASEDTGELAGLNMARNASSSSPKVKDKLAEACVAPEKTYDPLPFSRKHQTALWFNIGKGAHYDCVGLVDSKHLITRTVFLEGEESSAVVFYLRPEDNRLMGVLLWNITDELFKDPEYAAPSRLNLARSLVADRLILREDDEVLKCARQFDLGGEIAEHYEELKTFIEAKRAEDEAATAAAAEAIALVEKKAETTGINSQFSVKTETDAVVVPAPNNSSAV*