Search results


Species: Taenia solium
Id: Scaffold00151.gene7231
Length: 465
Strand: -
Start: 59400
Stop: 63482
Annotation: K12667 IPR007203 GO:0016021 Q5DD50
Function: ORMDL
Scaffold: Scaffold00151
Sequence:
>Scaffold00151.gene7231
ATGCAGGTTGGAACTGCAACCTCCACAGCAAACCCCACATCAGAATATCTTAACAGCACTGGAACCTGGGTCACATATCTTCTCCTCATTGCGGGTTGTCACCTCATTCTTCTCTGCATTCCGTTTCTCTCTGTAGCTTCAGTCTGGACGCTTACTTGCACTCTACATAATGTTTTGACCTACCTAATTCTTCACTGGGAGAAAGGCAGTCCCTACGAGACACTGGATCAAGGTGAAGCAAGGATTCTAACCCAATGGGAACAGTTTGATGATGGCGAACAGTACTCACCGACGAAGAAGTTTCTTCTTGTTGTTCCTATTGTCATCTTCATTCTGGCCAGTTTTTACACACAATACGATCCAATCCACTTTGTGATCAACGCGTCGACCCTCATTCTGCTGAGCATTCTACCGAAACTGCCGCAATTCTACCGTGTGCGCGTGTTCGGCATTAATCAGTGGTGA

>Scaffold00151.gene7231
MQVGTATSTANPTSEYLNSTGTWVTYLLLIAGCHLILLCIPFLSVASVWTLTCTLHNVLTYLILHWEKGSPYETLDQGEARILTQWEQFDDGEQYSPTKKFLLVVPIVIFILASFYTQYDPIHFVINASTLILLSILPKLPQFYRVRVFGINQW*