Search results


Species: Taenia solium
Id: Scaffold00146.gene7150
Length: 1353
Strand: +
Start: 109492
Stop: 126026
Annotation: K08891 IPR017441|IPR001452|IPR000980|IPR020635|IPR001245|IPR011009 GO:0004672|GO:0006468|GO:0005515|GO:0005524|GO:0004713|GO:0016772 Q70DV1
Function: Protein kinase, ATP binding site|Src homology-3 domain|SH2 motif|Tyrosine-protein kinase, catalytic domain|Serine-threonine/tyrosine-protein kinase|Protein kinase-like domain
Scaffold: Scaffold00146
Sequence:
>Scaffold00146.gene7150
ATGGGCAATCGTTCAAGCATCAAGTCTAGCACTGATATGATAGTTCCGCGTTCATTTGCCATACCTAGACGTCCGAAGATGGGAAGTGCTGTTCCTCAACTTCCTAATTCCCACTGGAAACCTCCAAAAAATAAGCAAAAGACCTTTGTCACATATGGAAATAAGTCTGAGACCTCACCCCACAAATTGGCCTACGGGACCTCCACCTACACGGAGCGACAAAATCGAGTGCATACCGTTCCTTACACCGCCAATCCCCTTCCTCAATCGTCCAACGCAATGACAACGACAGTCACACAGACAACAGCAGTGATGGCGCCTGTAGGAGGATGTCAGGCCACACCCACCAATCGCCTCATTCACCTACCTCGACCCTCCGATGCCTCGACGGTGGGAGCGTTGGCGGTAGCGCCCCCTGTCGCCCCTCGACACGCCACTGGAGACACATACCATCGATGGAGCCAGAAGTACGTAGCGCTGCACGACTATGCGGCGCGAGTGGAGGACGACCTCTCGATGTTGAAGGGTCAGCACTTCTACATCATGGACCGGTCGCAGGGTTACTGGTGGTATGCTAAATGCACCGACACTGGGAAAATGGGCTACGTGCCTTTCAATTACCTCGCTCCCATTGCCAGTCTCGAGTCCAACGAGTGGCATTTTGGCGATATGCGACGATTAGAAGCGGAGAATTGTTTGATGATGCCGGGGAATGATCACGGCTCCTTTCTTGTTCGGGTTAGCGAATCCAGAAGCGGGGAATATTCACTCTCAGTGCGGGACGGTGATGTGGTCAAGCACTATCGAATTCGATCACGGCCTTCAAGAACAAATCCTGATGTGCGACGCTATTTCATCTCACGCCAACTTCCCTTCTCCAGCATCCAACAACTTGTAGAACACTATATGAAAAACCAATCCGGTCTCTGTTGCGAACTCATTGCCCCCTGCATCAAGCCCGTTCAGCCTGTCCCAGTTGGTCTTTCACACAACACAGTGGACAAGTGGGAGATCCCAAAGTCCTCCGTCGTCCTCAAAGAGCGTATTGGAAAGGGACAATTCGGTGAGGTCTATAAGGCGGTCTGGAATGGCACCACTCTGGTCGCCGTCAAAACACTTCGTGCAAATTTGTGCAATGCGGAGGACTTTCTGATGGAGGCACAGACAATGAAGCGATTGCATCATCCACACCTCATCCAGCTGTACGCGGTGTGTACGCAGTCGGCACCCTTCTACCTCATCACAGAACTCATGTCAAAGGGCTCCCTGCTTGTCTTCCTCCAGTCCCCGGAGGGGCGAGCGTTGGGTGTGGCGGGTAGCGGTGCAGGTAGCCTCTGGCATGGCCTACCTTGA

>Scaffold00146.gene7150
MGNRSSIKSSTDMIVPRSFAIPRRPKMGSAVPQLPNSHWKPPKNKQKTFVTYGNKSETSPHKLAYGTSTYTERQNRVHTVPYTANPLPQSSNAMTTTVTQTTAVMAPVGGCQATPTNRLIHLPRPSDASTVGALAVAPPVAPRHATGDTYHRWSQKYVALHDYAARVEDDLSMLKGQHFYIMDRSQGYWWYAKCTDTGKMGYVPFNYLAPIASLESNEWHFGDMRRLEAENCLMMPGNDHGSFLVRVSESRSGEYSLSVRDGDVVKHYRIRSRPSRTNPDVRRYFISRQLPFSSIQQLVEHYMKNQSGLCCELIAPCIKPVQPVPVGLSHNTVDKWEIPKSSVVLKERIGKGQFGEVYKAVWNGTTLVAVKTLRANLCNAEDFLMEAQTMKRLHHPHLIQLYAVCTQSAPFYLITELMSKGSLLVFLQSPEGRALGVAGSGAGSLWHGLP*