Search results


Species: Taenia solium
Id: Scaffold00093.gene5789
Length: 2685
Strand: -
Start: 245176
Stop: 257399
Annotation: K01528 IPR022812|IPR003130|IPR011993|IPR019762|IPR001401|IPR000375|IPR001849 GO:0005525|GO:0003924|GO:0005515 C4Q0I5
Function: Dynamin|Dynamin GTPase effector|Pleckstrin homology-type|Dynamin, GTPase region, conserved site|Dynamin, GTPase domain|Dynamin central domain|Pleckstrin homology domain
Scaffold: Scaffold00093
Sequence:
>Scaffold00093.gene5789
ATGAGTGGGAATCGTGGGATGCAAATGCTCATCCCTCTTGTAAATAAGTTACAAGATGCCTTCTCTTCTCTGAGTGTGCCTTTAAATTTGGACCTTCCCCAAATTGCCGTTGTTGGCTCCCAGAGCGCTGGCAAAAGTTCTGTTTTGGAAAATTTCGTTGGCAGAGATTTCCTTCCGCGGGGATCCGGTATAGTCACCAGACGTCCACTCATTCTGCAGCTCATAAACAGCAATACAGTGCTTAATCTTACCCTGATCGATTTGCCTGGTCTAACGAAAGTCCCGGTGGGGGACCAACCGCAGGATATTGAGCACCAAATTCGATCCATGGTTCTTGAGTTTATAGAGCCAGAAAATACGCTTATCTTAGCTGTCTCACCTGCTAATACGGATTTGGCCAATTCCGATGCGTTAAAAATCGCTAAGGAGGTTGACCCAACTGGTATCCGGACGATTGGTGTTATTACGAAGTTGGATCTGATGGATGCAGGAACAGATGCTCGGGATATTTTGGAAAATAAGGTTCTACCGTTGCGTCGAGGCTATGTGGGTATCGTGAACCGAAGTCAGAAGGATATTGATGGCCGAAAGGATATTCAGTCGGCCGTAGCAAGCGAGCGGAAATTCTTCCTTGGTCATCCAGCCTATCGACACATGGCCGATCGAATGGGCACGGCCTATCTGCAGGCCACACTGAATCAACAGTTGACCAACCATATTCGTGACACCCTGCCAACTTTACGCAACCGTCTCCAGTCGCAAATGCTCAGTTTGGAAAAGGATGTGGAAGCTTTCAAGAGTCTCCGATCTGATGATCCGTCCTACAAAACCAAGGCTCTCATTCACTTGGTAAACAATTTTTCGGAACAATTTGTCAACACCATCGATGGTCATTCTGGGGCCATCAGTGTTGATTCTCTCTCCGGCGGAGCTGAGATCAATCGCATCTTTCATGAGCGCTTCCCTCTGGATTTGATAGAGATACAAATTGACGAAAAGGCTCTTCGACGGGAGATTGCCTACGCCATTCGCAACGTCCAGGGTATTCGCGGTGGTCTCTTCACACCGGACCAGGCCTTTGATGTGATCGTGCGAGACCGCATTGGTCGTCTATTGGCGCCCTCGCTATCCTGTGTTGACAGGGTGGTCACCAAGCTCTCCGCCATTGTGCACAGCTGCCTTGGTCAGATGAGCAGCTATCCGCTTCTCGCCGATGAAGTCGAAAGAACCATCAATCAGCGAATTCGGGAGTCGGAGGTGAAAACTAAGGACCAGCTGCGAGCTCTCACGGACTACCAACTTGCCTATATGAATACCAACCATGAAGACTTCATCGGATTTAACAACGCCGACCCACAGAGTGCAAATCAGGCAGCGAAGCAGAAAGTTGGCAACCAAATCATCTGTAAAGGCTGGCTGACACTTTTGAATGGCAAGCTGCTTCGAGGGGGTAGCAAGTACTTTTGGTTCGTTTTATCCACCGAATCCCTCACCTGGTACAGGGATGATGAAGAACGCGAAAAGAAGTTTGTCTTACCGCTGGAGGGTCTGAAACAGCGCGCCGGTGACACCTCTTTCTTCTCTCGACGTCCTAACTTCAGCCTGTTCCACTCCGATCCCAAGGTGAATGTCTACAAGGAGTTCAAGACACTGGATCTGGCCGCGGATACTGTGGATGCACGCGACAACTGGAAGGGGGCCCTTCTACGCGCTGGCGTTTTTCCCGAGAAGTCGGAACAAGTTCTCGACGATGAGAAGGATGACGATTTGAATCAGGACAGCAACCCAGTCCTCAAGCGGCAGGTTGAAACCATTCGAAATTTGGTTCAGTCCTACATGAAGATTGTCACCAAGACCCAACTGGATCTGGTACCCAAGATCACAATGCACCTCCTCATCGATGATGTCAAGAAGTTCTTGAAGTCTGACCTACTTCCGGCTCTCTATGCTCTGGACACGAATCGATTGATGGAGGAGTCACAGGAGGAGAAGCGACGAAAGCAGGACATGGTGATGATGTACAACACCATGAAGGAGGCACTAAACATCATTGCCGACGTGACCACTCATACTGTCACCACGCCTGTACCCCCACCAATCACAGACGATTGGCGTGAATCGGAGAGCGGGGGTAACGGGGGCTCGCCACGAGCAGGCACGGGGCCCTCTCGGCCTTCGGTCGGGCCGCAGCGGGGTAGTCCCCTACTGCCGTCTATGGGAGGCGGTGGAGGAGGAGGCGGCAGCGGCGGTTACATATCGCCACAGCCTCGCAATGCACCCATCCCACCCTCCTCACGACCCTTAAACCCCTCGGGACCTACTCCACAGGCGCCTGTGGTGCCCGCTCGCTCAGCCCCCCTAATCCCACAGCCCATCTCGTCGATTCACTCAAGTAATTCGGCTGGTGACCTCTATGCCGCGCCTATCGCTAACAGTAAGGCCTCCTCATTTGTCAACACTACCTCCAGCTCCTCCTCCTCCTCTTGGCACAGCAACAATCCCGGCCTCAAGGCGTTTGATCCCATCTCTTCATCTTCGGTTAACACCACCACCTCGGCTTCCTATGGCAACAATGGCACGCCTTCTACTACCGGTGGTGGTTACTCGGCACGGACTCTCGCCTCCATATTCGAAAACCGTCAGCCGACAGTATCCGGTCCACCCATACCACCCCGACCAAACTGA

>Scaffold00093.gene5789
MSGNRGMQMLIPLVNKLQDAFSSLSVPLNLDLPQIAVVGSQSAGKSSVLENFVGRDFLPRGSGIVTRRPLILQLINSNTVLNLTLIDLPGLTKVPVGDQPQDIEHQIRSMVLEFIEPENTLILAVSPANTDLANSDALKIAKEVDPTGIRTIGVITKLDLMDAGTDARDILENKVLPLRRGYVGIVNRSQKDIDGRKDIQSAVASERKFFLGHPAYRHMADRMGTAYLQATLNQQLTNHIRDTLPTLRNRLQSQMLSLEKDVEAFKSLRSDDPSYKTKALIHLVNNFSEQFVNTIDGHSGAISVDSLSGGAEINRIFHERFPLDLIEIQIDEKALRREIAYAIRNVQGIRGGLFTPDQAFDVIVRDRIGRLLAPSLSCVDRVVTKLSAIVHSCLGQMSSYPLLADEVERTINQRIRESEVKTKDQLRALTDYQLAYMNTNHEDFIGFNNADPQSANQAAKQKVGNQIICKGWLTLLNGKLLRGGSKYFWFVLSTESLTWYRDDEEREKKFVLPLEGLKQRAGDTSFFSRRPNFSLFHSDPKVNVYKEFKTLDLAADTVDARDNWKGALLRAGVFPEKSEQVLDDEKDDDLNQDSNPVLKRQVETIRNLVQSYMKIVTKTQLDLVPKITMHLLIDDVKKFLKSDLLPALYALDTNRLMEESQEEKRRKQDMVMMYNTMKEALNIIADVTTHTVTTPVPPPITDDWRESESGGNGGSPRAGTGPSRPSVGPQRGSPLLPSMGGGGGGGGSGGYISPQPRNAPIPPSSRPLNPSGPTPQAPVVPARSAPLIPQPISSIHSSNSAGDLYAAPIANSKASSFVNTTSSSSSSSWHSNNPGLKAFDPISSSSVNTTTSASYGNNGTPSTTGGGYSARTLASIFENRQPTVSGPPIPPRPN*