Search results


Species: Taenia solium
Id: Scaffold00079.gene5290
Length: 2277
Strand: -
Start: 315880
Stop: 325984
Annotation: K04400 IPR015917|IPR002398|IPR020683|IPR011600|IPR016129|IPR002110 GO:0004197|GO:0006508|GO:0006915|GO:0008234|GO:0005515 C5J937
Function: Peptidase C14, caspase precursor p45, core|Peptidase C14, caspase precursor p45|Ankyrin repeat-containing domain|Peptidase C14, caspase catalytic|Peptidase C14, ICE, catalytic subunit p20, active site|Ankyrin repeat
Scaffold: Scaffold00079
Sequence:
>Scaffold00079.gene5290
ATGCCTCAGACAACATTGAGGAATATCAAGCGCTTACCCTCATCCAGCTCGACATCCACTTCGGCAACGGATGCAGGGATACTACTGCAGTTGCTTCGAAGGGAATTACTTCTGGCCTTAGAGAGTATGGATGGTGCTGTCTTCAAGATGAAACTGCAGTGGATCTTGGAGAATGCTGGAGAATTTGTGGATCTGGTGCTGATGAGTGGACTAGACTTGGAGGGCAAAACCGCCCTTCACATTGCTGTGGAGAATCGCTTTGAAGAAGCGGTTAAGCTTTTGGTCTCAACGGGTAAAGTCGACCTTCTTGCAACAGCTGGTGACAGTGGATGGAGTGCTCTACATACCGCAGTTGACCTTGGTGATGCCAAACTTACACAGGCTCTCCTGCCAATCCACAATGCAGTTATAACACCACATCGCATCCTCTCCTCGCTTAAACAGCCCACTGCTTCGCCCTATGCCGTCACAGCGTTGCACATGGCAGTCCGTCGAAATAGTGCTTCATGTGCAGTAGTGCTTCTACACGCGGCAAATGCCCTGCTGGATGGTCATTTAGGTGGTTGGACGTCCTCGGAGGAGGAGGAGGAAAATTTAGCATCAATGGATGAGATTCAGCAGAAAAACCACTTCCATGGACAGGCGGGCAAGGGCTCTCAAAAGTTGATTAAACTGAAGGATAGAAATGGTGATACACCATTACATTGGGCAGTGAAGACAAACAATTATGCAATGGCTCGTCTTCTCTGTTCCTATGGGGCTCGTCCACGTCATTCGCACAATTGTCAGGGACAAACACCCTTCGCTTTGGCCAAGTACGTCCTACGCAACACCAAAATGACCAAACTACTGGCCAGTTTCTCACCAACATTCAACACCAATACCACCCACAATTTTGAAAACGACAATGACGCGACTGAAAGCCGAGAGCACGAAGAAATTCTACCCTTTGAATCACCCTCACCAGGTAACTCAACTCTTCAAAGGGTTCCGAAGACATCCGAGGTAGATGGTAGTTGCCGAAAACTGGAACAGACGTTGCTTGCCGTGGAAATGCCAACTCCGCCAACAGGAACGTTAATAGCAACAGCGATGCCTGCAAAAAAGTCGCCTTCTGGAGAGGCATCAAACGGCGGAAGCATCTTAGCGAGGCCCTACCTTCACCGTAAAGTCAAGTCAACCATTCCCCAAGGTCCTCTGGATTTGAAGGTTGAATCGGACACCTTAGAGACGAGTAGACCTCGATCGTACAGCCTGAAAGTGGAACGAAGGGAGTTGGATATGCTTCGACAGAAGGTACCCAGTCTCATTCCTCGACCTCAACTCAAGAGAGCAGTGGTTCACCGACCACGTCCAGTCTCCCTGAAGGCTCGTCGAAAAGCTAGTTTGATGGACCCCGTCGAGTACTATCCCATGGCAAGTTCGCGACGCGGTATCTGCGTCGTGATCAACAACATGACCTACTGGCACCCCAAGTTTCAGAATCGCGGTGGCTGCGATAAGGATGAGAAACGAGTGGAGAAGGTCTTCTGCGGCCTCGGCTTCCTTGTAAAGGTTCTTCGTAATCTGTCCTCTGGTGAAATGCGCTCTGAGCTTGCCTTCATTGGTAGCAAGACTGATCATTCTGCTTATGATGCTTTTGTTGCTGTGATCATGACCCACGGAGGGTTGGGAGAACTCTATGGAGTCAATGGAGACGCCTTTCCAGTTCACCAGTTGACTCTTGACTTCACTGCAGAAAGGTGTCCATCTCTAGCTGGCAAGCCGAAGCTCTTTTTCATTCAAGCCTGTCGTGGCGACGATTACCAGTTCGGTTACGCGTTACCAGCTGCTGCAAGCGTCGAAGATGCGGCACCTACGAACCCCGGATCTGCACTCTCTAATCCTCTTGAAATTGGTATCACGCAGGTGGAGGGAGAGACAGTCGAGGAGGCGACAGAAGATGTGGAAGAGAAGCCACCAATAGTTGCAGCAAAGTTGCCACGCAAACAACGACTGGTTCCGAATTTTGCAGACTTTTTACTGAGTTATGCCACATTGGCGGGTTTTAAGGCTCAAAGAGACCCGCAACAGGGATCTATCTACATCCAGACGTTGTGTCACCACTTGGAGGTGTATGGAAGGTCGAGAAGTCTGTTGGATATCGTCACCTCAGTACATCGGGAAGTGTCAGAGAAAGTCTTTCGGGAGGCGGAATCACCCGATCAGGAGGGCACAGTGTTTCAACAGACTCCCGAAGTTCGACACACCCTAACTCGGAGAGTTCAGTTCGTGTGA

>Scaffold00079.gene5290
MPQTTLRNIKRLPSSSSTSTSATDAGILLQLLRRELLLALESMDGAVFKMKLQWILENAGEFVDLVLMSGLDLEGKTALHIAVENRFEEAVKLLVSTGKVDLLATAGDSGWSALHTAVDLGDAKLTQALLPIHNAVITPHRILSSLKQPTASPYAVTALHMAVRRNSASCAVVLLHAANALLDGHLGGWTSSEEEEENLASMDEIQQKNHFHGQAGKGSQKLIKLKDRNGDTPLHWAVKTNNYAMARLLCSYGARPRHSHNCQGQTPFALAKYVLRNTKMTKLLASFSPTFNTNTTHNFENDNDATESREHEEILPFESPSPGNSTLQRVPKTSEVDGSCRKLEQTLLAVEMPTPPTGTLIATAMPAKKSPSGEASNGGSILARPYLHRKVKSTIPQGPLDLKVESDTLETSRPRSYSLKVERRELDMLRQKVPSLIPRPQLKRAVVHRPRPVSLKARRKASLMDPVEYYPMASSRRGICVVINNMTYWHPKFQNRGGCDKDEKRVEKVFCGLGFLVKVLRNLSSGEMRSELAFIGSKTDHSAYDAFVAVIMTHGGLGELYGVNGDAFPVHQLTLDFTAERCPSLAGKPKLFFIQACRGDDYQFGYALPAAASVEDAAPTNPGSALSNPLEIGITQVEGETVEEATEDVEEKPPIVAAKLPRKQRLVPNFADFLLSYATLAGFKAQRDPQQGSIYIQTLCHHLEVYGRSRSLLDIVTSVHREVSEKVFREAESPDQEGTVFQQTPEVRHTLTRRVQFV*