Search results


Species: Taenia solium
Id: Scaffold00077.gene5203
Length: 5472
Strand: -
Start: 2611
Stop: 31204
Annotation: K05699 IPR002017|IPR001584|IPR018159|IPR012337|IPR001715 GO:0005515|GO:0015074|GO:0003676 D2A0Z1
Function: Spectrin repeat|Integrase, catalytic core|Spectrin/alpha-actinin|Ribonuclease H-like|Calponin homology domain
Scaffold: Scaffold00077
Sequence:
>Scaffold00077.gene5203
ATGGTGGAGGCCTCCAGCAAACGCTACTGGTGGTCTCCTCTTACCCCGGACGTGCTAGATTTCTGCCGAACTTGCATCATTTGTAGCAGTTTCAAGAAGCCTCACTCTACAGCAATCGCACCTCTGCAAGCCATGCCTTCGGGGTTCCCGGGTGAAAGATTGGGGGTAGATATTATGGGCCCTATGCCACTTACTAAAAGGGAAAACTGCCATATCCTGGTTATGGTTGACTACTTCACGAGAGTGGCCGAAGCAGAACTCACGAAGTCTCAGGACGCCGAAGCAGCCGCATCAATCTTCTTCAATCGTTGGATCTGTCAACACGGAGTGCCCGAACCAGTCCATGCCGATCAAGGTCCTAACTTCAAAAGCCGACTCATTATTGAACTATGCAAGACTTTCGGAATCACAGAGACGTGCAAGACACCTGGGCACCCACAGGGCAACGGACAAGTAGGAAAAACCAATCGCGCCTTAATAGGACTGCTGGAGGCTTTTGCTAAATTGGCACAGCCTGAAGATTGGAATTTAAGCCTGGGACGCACCCTTCTTGCGTATAGAGCTACAGTTCACACATCAACCTTTGTTTCCCCGTTCAAGATGCTCACAGGTAGCAAAAGGAGAGTTCCCTCCAATGTCTTCCTTCCGAGCAAGGAAGCGGCAACCGACAATGCTGCGAACTACGTACTACGGCTAAAAGAAGGGACTGAAGTTGACTTAGATGAGGCTCGGGCGCTTCAACAAAAGAAGATATTTACGAAATGGGTTAATGCCCACTTAGAGCTAGCTGATCAAATGGCCTTTGAAAAGCCATTTATTAGCAGTTATCTCCAAGGTGGCATCAATGAAGACAATGTCGAAGGACATTTTGCTTTAAGCTTTAAAGGCAATGAACAGCTTTATAAAGTGAAGGACCTTTATAAAGATCTTTCCGACGGGAGGGTGCTTTTGCGTCTCTTGGAGTTCTTTACTGGCAGAAAGATCACACTGTCTCGTGGAAAAATGCGTGTTCACTCGCTAGAGAATGTTAGCAAAGCCCTGGATCAAATGAAGCAGATGAATATACACCCAGGAAACATCGGCCCCATCGATATAGTGGATGGAAATGTCCACCTCATCCTTGGTCTCATCTGGACCTTCATTCTCAAATTTCAGCTCTCTCGTCCACTCTTCACACATCACCAGGAGCATGAGTCACCAGTTGAGATGAAAAACGCGCTTCTTCGATGGTGTCAATTGAAGACGGCTCCCTATCCGCAGATTAACATCGCCAATTTCACCTCTAGTTGGAGGGATGGTCTAGCGATGTGCGCCCTTCTGCATCGTCACCGACCCTACCTCATTGATTTTGCTGCTCTTGCGTCAGCAACTACATCGCCAATAAGTCGCCTTTCGGAGGCATTCTCTTTGGCCAAAAGGGCCTTCCGAATACCCACAATCATTGATCCAGCTGACTTCGTTGCTTGCAGCAGTGATGAGCGTTGTGTGGTGGCTGTAGTCGCTACTTGGTATCATCGTTTAAACGAGGATCAAGAGTTTAAAAAATCTGCTTCGCGTCTGGCTGTAGTACTTGACAGAGTGATGACATCAGAACGGAGAATGATGGCGTATGTGGAGGAGGTCCATGCTTTTCGAAGGTGGATGAGGAAAAATTTGCAATACATTGTGGAACTAAGCAAATTTAAAGATGTTAAGCTCATCTCCAGCAAGCTTGCCCAATGGAGGGAAAATGAGAAAGAAAAGAAAGTGGAGGAAATTGGGCAGATTGAGATCTTAGCGGAGATCATTAAATTACGAAAAGTTTTAAAAGAGATTGAACAACGCTTTCTGCTACCCACTGATGTCAATCCTGAAGACCAGGTACGAAAAGATAGCGCCAGAAGTTTCCAACGAATAGCGGCTCAGACACAAAAAACCATCCATATGGAGCTCACCAAATTACATCAGAGTTTGAACGAGATTAATCAAGAAGCCACGACGCGACATGAACAGCTTCTTGCGGAGCGGGCGAAAATACACGCCATTCAGAGGTGTTGTGAACTGCTGCAGTGGATTCACCAAAGTCAAAAATGCCTCTCAGAAATCGAATCGCCATTCCTCCATCTGTCCACAAAAGCCTCAACTGGGTTCTTTTCCCTAATAACAAATGAGCCTTTCCTTGTGGCCTTGGAAAAGGAGGTTAACTTCCACACTCGAACATCTCTCCCAACCCTATACGATTTTCAAGCTCGCCTCCCCAATGATTCCTCGTGGAACACTCTTCTTGAGCACACCTATAATGCCTGGAATGATCTCATTCACATTGCTAAGATGAAACGCCTCTCCATTGATACTGCAAAACGTCTCGTGTATCTTACTGAGGAGTTACTCAACACCCGACGTTGGGTGAAGCAAAAGAAGGAGTTACTTCTCGCTACGGTTGAGACAAAATACACCATGAAAGAAATGATTCGCAGAGAATGTCGAATGGATGGTTGGGAGACTGACCTGAATGCTCTCAAGGAGCGAGTGGGTCAGGTGCTTGTAAAGATAGACACTTTGAACATTGCGCTGGAGGACCTCCAATCGCCCTTGAGTTCGGAATCAGAGAGTGGAGTGGCTGTACGAGGAGCAACGTCGATCCTGGAGGAGTTGCGCTCGAATTTAAGCACAGAATGGGAGGAATTAATGGTCCTCCTCAATGAATACCAAAAACGGCTAGAGACTTCACTAGCCTTCCAGAGCATGTTACAGGAGTTGGAGGCAATGAATACCGTACTGATGAGCAAGCATAACACAATAACTTCTCTGGAGTTACCAACCTCCATCAGTGAAATCAATGAGCAGCTGGAGGTCTTCCATACCATCGCCACCGAGTTGGAGTCGTTAAATGAAAAGTTGGAGGCCTTAGTGGTGCACGGAAAGGCCTTAGTTGCAAGTCAGGAAGAAGTTGTCGCAATAGCCGTCACGGAGAGGCTCGATACTCTCAAATGCGAGTGGTCGGATCTACTCATCCTGTGCAATCATCAGCTAGCCAGTCTGGCACATCAGCGTGACATTAAACCCACAACTGAGCACATTCGTGGCAAAATTATGACACAAAAACAGGTGCTCATGTCAATTCAGGCCCTCTCTGATCAAGTGAGGCTGCTACAATTAAAGTCCGATGAACATAAATTTGGTGAAAAGTACACAAATATTCAAGAGAAGGCTGCTGATGCGCTTCGTTTGCTGGAATTTCGCCTCACCGAGAAGGAGAAGTTGAATCAACTAAAGAGCATTGAAGAGTGGATTTTGGAGCGTCAGACGGCTGTAACTGCGCAATTCATCGCTGATGATGCAACGCTGCAGGAGCAAAAGGCCATTCAGAAGTATCACCTGCTTAGAAATTTCGAGGCAGAAGTAAAGAGCTACGGATTACTAGCCAGCGAAATCTTTCAGAGTGCACAATTAACAATAAAGGAAAACCAGACAATGTCTGCATGCCTGCAGGAAGCCCTCGATGGCACTATGGAATTGTGGAATGAATTGAACACCACACTGGCTGTTCAGGGTGGAAAACTGGTTAAAGTGTATCGAGCAATCATAATCTCCGAGGGCTGTGAGGAACTCCTGGAATGGCTTAAGAGAGCAGCGGTGAAAATATTTGGTCTACAAGTTTGTGACTACAAGAAACCCACTGACTCCTCCCTACAGCATCCGACTTTCAGGTCTGTATCCATGACCTCACTATTGGTTGACTCTTCTGGGCCAGGGTCACTAGCAAGGCTAAAACGACGATCAGTCTCCGAGAACTGCCTTCATTTCCTTACTACTGTTGGTGTGAATTGTGATGATACCTTTGACCTCAGCGCTTTGAAAACCGCGATGGTGAAAATGGATGAATTAAATTTACAGATGCAGAATAAACGCTCTTTCCTCCAGGAATTGAAACGACACTACCAATGCCTGATGGAGGATACCGATAAATTTGCTCAACATGAAGAAAAGTTGCGACATGTTATTGCTCAGTTTGACAAGGTGAAAAAGTGGCTCTCCACTTGTGCTCTCAGTGTCACCAGCTATCAAGAAGTTTTTAATGCGCTACGGACTCTCGGGGATGAGAATCAGTGGTTGGCGCAGAAGCAGACCCAGCTAAGTAATGAAAACACGGTGCATTCTTTGTTAGAGGTTCAAAAATCACTTATTAGACACCAGAATGTCACCGCCGAGACGGCTATCGAGTGGCTTCGATTGGGCGAAGTTCTAAAGGCTCAGGTGATTCACCCAGCCAAGGAGAAGACCTGCTGTGTAGCCTTCATAACGGCGCATCAGGATCTTTCAAAGGAGCTCTTAACAAAAATTAGTGAACTGGTGTTTCGGCAGGCTGTGTTACAGCGAGAAATTGGCGTGCGACGCACAGTCCTCCATCATTGGCAAGCGTGGTTTGTTCAGCATATGGATCTGTTGGAACTCTACAACTGGCTAACTGAGACGGAGTCCACTGTAATGACAGAATGCCACGCAGCTCGAGGACTTGCCTCGGCCCATGCGGCTATTAAGAAGCATTCAGTAGTTGAGGCTATCGTCTCGGAATTCCAGGCACCAAGACTTCGAAATTTGAGCGCTCGAACTGCTAAGCTGCTTTATGCAATCGAGAATATGATAGCAGCTGAACAGAAGAAGCTGTCACGTTATTTAAAAATTGCTGCTTTCTTCGTCAACACCTATGAAACCGCAAAGATGAATCGGCATAAATTGCGCCGACGAATCCACATGCTGGAAAGATCCAGTGCCAAACTGCTCTCCACACAGACCTCGGTACAGAAGCAGTTCACAGATCTTCGTGATTTAGTAGTGGAGAAGAAGCATCGACTTTATGAACTGCTCGCTTTGAATAGACTCTATGAGGAAGTCAGTGATGTAGAGGAGTGGATCTGGAGCCGAACCGAAGAAGTTCTGGTCGAAAACACGGGAAGAGACTTGGACGAGTGGACCCATCTGCAACGTGACTTCTGTGACACCTATCGAAGGTTAATTCGTAATGAAGTCACGGATCAATTAGTACATGAAGACTTGACCTCTACACCCAAGTTACCCGATGATTTCGCATTACTTGGTCAGTTGCCACCACTTTCCGACGGTCCGGAGCGCCTGGTTCGTGCTATTATGGTGTGTCGACAGATGATTTACTTGAAGCATTCCGACTCACCCCAAATTGCTCGGTGGCAAGATCGCCTAAATGAGGATTGGCGTGAGTTGAGAGAACTTCTGCAAACCAGAGGCGAGTTGCTCAAAATTGCTGGAAATCGACTGCTTTTTCTTCAACGTTGTGAGGAGGCGACAACTGATTTACGCGAAAAAATGGACAGTTTGCCTGCGATATTGGGCACCGATTCACAGGTCTTGGCACGTCAGCAGCGTCAACATGCGAATTTTCGCCAGTCAGTGATCCCCATCGGTAAACGGGTAAAGCGCTATCTGTTTTGCGCATTCAATCAAAATGCAGAATAA

>Scaffold00077.gene5203
MVEASSKRYWWSPLTPDVLDFCRTCIICSSFKKPHSTAIAPLQAMPSGFPGERLGVDIMGPMPLTKRENCHILVMVDYFTRVAEAELTKSQDAEAAASIFFNRWICQHGVPEPVHADQGPNFKSRLIIELCKTFGITETCKTPGHPQGNGQVGKTNRALIGLLEAFAKLAQPEDWNLSLGRTLLAYRATVHTSTFVSPFKMLTGSKRRVPSNVFLPSKEAATDNAANYVLRLKEGTEVDLDEARALQQKKIFTKWVNAHLELADQMAFEKPFISSYLQGGINEDNVEGHFALSFKGNEQLYKVKDLYKDLSDGRVLLRLLEFFTGRKITLSRGKMRVHSLENVSKALDQMKQMNIHPGNIGPIDIVDGNVHLILGLIWTFILKFQLSRPLFTHHQEHESPVEMKNALLRWCQLKTAPYPQINIANFTSSWRDGLAMCALLHRHRPYLIDFAALASATTSPISRLSEAFSLAKRAFRIPTIIDPADFVACSSDERCVVAVVATWYHRLNEDQEFKKSASRLAVVLDRVMTSERRMMAYVEEVHAFRRWMRKNLQYIVELSKFKDVKLISSKLAQWRENEKEKKVEEIGQIEILAEIIKLRKVLKEIEQRFLLPTDVNPEDQVRKDSARSFQRIAAQTQKTIHMELTKLHQSLNEINQEATTRHEQLLAERAKIHAIQRCCELLQWIHQSQKCLSEIESPFLHLSTKASTGFFSLITNEPFLVALEKEVNFHTRTSLPTLYDFQARLPNDSSWNTLLEHTYNAWNDLIHIAKMKRLSIDTAKRLVYLTEELLNTRRWVKQKKELLLATVETKYTMKEMIRRECRMDGWETDLNALKERVGQVLVKIDTLNIALEDLQSPLSSESESGVAVRGATSILEELRSNLSTEWEELMVLLNEYQKRLETSLAFQSMLQELEAMNTVLMSKHNTITSLELPTSISEINEQLEVFHTIATELESLNEKLEALVVHGKALVASQEEVVAIAVTERLDTLKCEWSDLLILCNHQLASLAHQRDIKPTTEHIRGKIMTQKQVLMSIQALSDQVRLLQLKSDEHKFGEKYTNIQEKAADALRLLEFRLTEKEKLNQLKSIEEWILERQTAVTAQFIADDATLQEQKAIQKYHLLRNFEAEVKSYGLLASEIFQSAQLTIKENQTMSACLQEALDGTMELWNELNTTLAVQGGKLVKVYRAIIISEGCEELLEWLKRAAVKIFGLQVCDYKKPTDSSLQHPTFRSVSMTSLLVDSSGPGSLARLKRRSVSENCLHFLTTVGVNCDDTFDLSALKTAMVKMDELNLQMQNKRSFLQELKRHYQCLMEDTDKFAQHEEKLRHVIAQFDKVKKWLSTCALSVTSYQEVFNALRTLGDENQWLAQKQTQLSNENTVHSLLEVQKSLIRHQNVTAETAIEWLRLGEVLKAQVIHPAKEKTCCVAFITAHQDLSKELLTKISELVFRQAVLQREIGVRRTVLHHWQAWFVQHMDLLELYNWLTETESTVMTECHAARGLASAHAAIKKHSVVEAIVSEFQAPRLRNLSARTAKLLYAIENMIAAEQKKLSRYLKIAAFFVNTYETAKMNRHKLRRRIHMLERSSAKLLSTQTSVQKQFTDLRDLVVEKKHRLYELLALNRLYEEVSDVEEWIWSRTEEVLVENTGRDLDEWTHLQRDFCDTYRRLIRNEVTDQLVHEDLTSTPKLPDDFALLGQLPPLSDGPERLVRAIMVCRQMIYLKHSDSPQIARWQDRLNEDWRELRELLQTRGELLKIAGNRLLFLQRCEEATTDLREKMDSLPAILGTDSQVLARQQRQHANFRQSVIPIGKRVKRYLFCAFNQNAE*