Search results


Species: Taenia solium
Id: Scaffold00058.gene4524
Length: 2349
Strand: +
Start: 115329
Stop: 139268
Annotation: K08891 IPR017441|IPR001452|IPR000980|IPR002290|IPR008266|IPR020635|IPR001245|IPR011009 GO:0004672|GO:0006468|GO:0005515|GO:0005524|GO:0004713|GO:0004674|GO:0016772 Q9NH62
Function: Protein kinase, ATP binding site|Src homology-3 domain|SH2 motif|Serine/threonine-protein kinase, catalytic domain|Tyrosine-protein kinase, active site|Tyrosine-protein kinase, catalytic domain|Serine-threonine/tyrosine-protein kinase|Protein kinase-like domain
Scaffold: Scaffold00058
Sequence:
>Scaffold00058.gene4524
ATGGGCAACTGCATAAATAAGTGCCAGAAAACCATGGGAGCTGATGAACACCACCCGGCCACTCCTCACACCGAACGGCCCCTTCCTCCCCGACCCCTTTCGGGCACCCTTCCCAACGGATCACCCGATGTCCCTTGCCTGGAACCTATCTCTAACATTGTGGACAATGAGCCCTATCCCTTTAATTTCACCAGCACACCTCCCTCCAAATCTCGTCAAGTCTTCACGGCTTACCGCGCGGACTCTAGGGATAAAGTGAACATCTTTCCCTCCCATGACTCACCTATCGCCTTCTCTTCTAACCGCCCTGTAGCAGTGACCTGCGCACCCTGTGTTTCCTCTGCCTGCCCCCAATTTCATCCCCCTCTCGTCTCTATCGCGCAACGCGTCCCTAGTAGCCTGCTCTCCGGTCACAGTTCTCGGTCCCACTCCTTGCCCCGTGCTAACGGTAACAGTGGCACACCTAAGAACTCTATTCCCTACCCTCCTGCCATGATCACTCGAAATTTGGACTCAGAGTCGCATTTCAAGCGCAGTATTGAATTCCGTAATTCTCCTCGAACACCTCGGAACGATGCGACCGAACGGTTTCACCGAGCAAGCATTGGTGCATCGATTGATACGCGCAGTGCTGCACGACATCCTTATGGCGATCCACAATCTAATCCTTCCGAGTTGTCAAATCGTCTGGTTGCAATTTTTGACTACAATGCGAGGACAGATGAGGAGATTTCGTTGAGGAAGGGCGATTCCATGTTAACTCTTAATGACAGTGACGCCGAGTGGTGGTTCGTGGAACACTGCAGAACCTCCGAGAAGGGCTACGTTCCATCCTCCTACGTCGCTGTGGCGGGTTCTCTTGAGGCGGAGGAGTGGTACATACCGAGGATCTCGCGGAAGGACTCCGAACGTCTCCTTTTGTTAAACAGCAACACTCCGGGCACCTTCATGATTCGTGACAGTGAAACAGCTCAGGGCACCCTGACCTTGTCCGTCCGAGATCGCGAGGTGGACGCCACCACCTCGCACGCCACTGACACGGTGAAGCACTATCGCGTGAAGCACTTCGGTGGTGGTAGCGGTGGTTTCTACATCTCCACGAAACGCGGTTTTCCCAGCCTGCGTGACCTCGTGGAGCACTACTCGGCAGAGGCGGATGGCCTCTGTCGACGCCTCACTCGTGCCTGTCCTCGACCTCCTCCCCTGACTTCTGACCTTTCGGTGCAGACGAAGGACCACTGGGAGATTCCTCGAACCTCAATCACCCTGTTACAGCGCCTTGGTGCGGGACAGTTTGGCGAAGTCTGGAAAGGCACATGGAACGGAACAACGGAGGTGGCAGTAAAGATGCTGAAGCCGGGCGCTATGTCGAAGGAGGAGTTCCTCAAAGAGGCGCGCATCATGAAGGCGGCACGACATCCACGACTGGTGCGTCTCTACGCTGTGTGCGTGGAGGATCCCATCTACATCATCACCGAGCTGATGCCCCATGGTAGCCTCCTCTACTACCTTCGTGATGGTCCTGGACGTCATCTCACCCTCCGACCGCTAATCGACATGATGGCTCAGATCGCTAGCGGAATGGCCTACCTAGAACGCGAGCGCTACATCCATCGCGACCTAGCGGCACGGAACATTCTGGTGGGCGAGAACAATGCTGTGAAGATTGCGGACTTTGGACTGGCACGGATGGTTGTGGAGGAGCGCTACGAGACGTATGTAGCACAGAATGGTACCAAGTTACCCATCAAATGGACCGCCCCAGAGGCTGCGCTCTCGGGACGCTTCACGGTGAAGTCGGACGTCTGGTCCTTTGGCATTGTCCTCTACGAGATTATCACTCACGGACAGGTGCCCTACCCCTCCATGAACAACACGGAGACTCTAAACCAAGTGAGCTCCGGGTACCGCATGCCTCGTCCATCCGCCTGTCCTGAGGGTGTCTATGAAGTGATGCTCCAGACGTGGGACGCCACTCCAGAGCGTCGACCGACCTTCGAGTACCTGTGTGCCTATTTTGAGGAGTACTTCGTTGCCTCCGAACCCACTGGCTATCATCAGCGAGACCATCGTAATGCCGCCATCACCAACGAACCGTCTCCAGGAGGTCTCTCGCGTTCACGACATCGAGACGAGGGGCTTGTCGAGAGGTTGGATGGAGTAGAAGATGTGGACGTGAATGTAATAGTGAGGGGTGAGGAGGAGGAAGAGGACGAAGATTTGGATGCAGAGATTATGAATTTGGCAAGAACTGGGACGGAATTCCATCACCATCATCAACGAAGCCATCACAGCCACAACCATCATCCCTCGCACAACGATGCCCCAACTCCGATGGCTGTGGTGTGA

>Scaffold00058.gene4524
MGNCINKCQKTMGADEHHPATPHTERPLPPRPLSGTLPNGSPDVPCLEPISNIVDNEPYPFNFTSTPPSKSRQVFTAYRADSRDKVNIFPSHDSPIAFSSNRPVAVTCAPCVSSACPQFHPPLVSIAQRVPSSLLSGHSSRSHSLPRANGNSGTPKNSIPYPPAMITRNLDSESHFKRSIEFRNSPRTPRNDATERFHRASIGASIDTRSAARHPYGDPQSNPSELSNRLVAIFDYNARTDEEISLRKGDSMLTLNDSDAEWWFVEHCRTSEKGYVPSSYVAVAGSLEAEEWYIPRISRKDSERLLLLNSNTPGTFMIRDSETAQGTLTLSVRDREVDATTSHATDTVKHYRVKHFGGGSGGFYISTKRGFPSLRDLVEHYSAEADGLCRRLTRACPRPPPLTSDLSVQTKDHWEIPRTSITLLQRLGAGQFGEVWKGTWNGTTEVAVKMLKPGAMSKEEFLKEARIMKAARHPRLVRLYAVCVEDPIYIITELMPHGSLLYYLRDGPGRHLTLRPLIDMMAQIASGMAYLERERYIHRDLAARNILVGENNAVKIADFGLARMVVEERYETYVAQNGTKLPIKWTAPEAALSGRFTVKSDVWSFGIVLYEIITHGQVPYPSMNNTETLNQVSSGYRMPRPSACPEGVYEVMLQTWDATPERRPTFEYLCAYFEEYFVASEPTGYHQRDHRNAAITNEPSPGGLSRSRHRDEGLVERLDGVEDVDVNVIVRGEEEEEDEDLDAEIMNLARTGTEFHHHHQRSHHSHNHHPSHNDAPTPMAVV*