Search results


Species: Taenia solium
Id: Scaffold00052.gene4267
Length: 2298
Strand: -
Start: 304093
Stop: 322059
Annotation: K05699 IPR014837|IPR002017|IPR018159|IPR002048|IPR011992|IPR001715 GO:0005515|GO:0005509 C4Q6R2
Function: EF-hand, Ca insensitive|Spectrin repeat|Spectrin/alpha-actinin|Calcium-binding EF-hand|EF-hand-like domain|Calponin homology domain
Scaffold: Scaffold00052
Sequence:
>Scaffold00052.gene4267
ATGACTCTCGGAATGATCTGGACTATCATATTGCGTTTCTGCATTCAAGATATCACTGTAGAGGAGCTTCACGCTAAAGAGGGATTACTACTCTGGTGTCAGCGGAAAACGGCGCCTTATAGTAACGTAAATGTTCAGAACTTTCATACAAGTTGGAAGGATGGGCTTGCTTTTTGCGCTCTCATACATCGACATCGTCCAGAGCTTATTGACTACGCCAAACTCTCGAAGGAAAATCCGATTCAGAATCTGAATTATGCCTTTGATGTGGCGGAGAAATATCTTGATATTCCTAAGATGTTGGATGCCGAAGATATGGTTAATACAATTCGACCGGATGAGCGATCTGTTATGACCTACGTTGCCGCCTATTATCATGCATTTGCGAACGCCAACAACACCGAATCAGCTGCTAATAAGATAGCAAAAGTTCTGAGGTCCAATCAAGACACGGAAAAATTAATGGAGGAGTACGCTGGTTTGGCCTCGGATCTCCTTAAATGGATAAGTAATCAAATCCCCTTCCTAGCGGATAAAACAACGGATGGCACTTTGCCCCATGCAAAAGAAAAGCTTGCTCAATATACGGTCTACAGAGGTTCGGCGAAACTACCACGTGTGGAGGATAAGGCGTTGTTGGAAGCTCTATGTAATACAATCCAAGCGCGTCTGAAACTTGCTCACAAACCTGCCTTTATGCCACCGGCAGGCCAGTCGATTGGTGAGATTAACGATGCATGGAAGCGGATGGAAGATACGGAGAAAGGATTTGAGGACTGGCTTCTCAACGAAATTCGTCGTTTGGAACAACTTGATTATTTAATTAAAAAGTTCAAATTAAAGTGCTCTACCCATGAGGCCTGGTCAAAAGACAAAGAGGCGACATTGAGTGCACGAGACTACGAAAATGCCTCCTACGCTGAACTTATCGCTATGGCCCAAAAGCAGAATGCTTTCGAGACCGATCTAGGTGCTCATCAAAATAGGGTTGAGAAGATTGTATCAATCGCAGAGGAACTGAAGTATGACCTATCGCAAAACTCCTTACGTTCTGCTTTTAGTGCTCTTCAGTACGAGGATGTGACCAATGTGAATAAGAGGACACAAGATATTGTCTCACAATGGGACAGACTGGGAGAGATTTCTGCTAGAAGGAAAGAAGAAATTGAGTCCTTCTCCAACTGGTTGGAACAGGCGGAGGAAGATTTGCGAGATATGTTTATTGCGGATCGAGTGGAAGAGGTTTCGCAACTGATAAACGGCCACGAAGCCTTCAAACGCGCGTTACCTGCAGCTCAAGAGGAGTTGAATTCGATGCTTTGCGAGGCTGCAGAAATTGACCGGTTGATTGAACAGAACGACCTACCACATGAGGTGGCCATCAATCCGTATACCATGTTTACATACGAGACTCTCCACGACCGCTGGGGTTGCGTTCAAAAGCTTGTACCTGAGCGTGACTCCGCGCTAGAATCTGAGTTGGCAAAGCAACAAAGTAACGAACGAATGCGTGCCCAGTTCGCCATGCAAGCCAATCGGTTGGGGCCCTGGTTGGAGCGTGCGCTAGACGCACTGTTTGCAGCTCAGAGCAATCCTGCGACGGCTCAATTGGAGCAACAGATGGGAGCATTTAAGAGGATGGAAGAGGAGTTAGAGAAGATAAAACCCATCATTATGGAAGCGGAACGCTGCTATCAGCAACTACAAGAAAATGGCGTCTATACAGTGCCTCAGACCCAATACACCATGGACACACTTCGTCTGGGTTGGGAACAGTTTCTCACAAATCTAAAACGTGCAATCAACGAGGTGGAGGTGCAGATCATGACCAGTGAGGCGCATAACATTAGCGAGGCTCAGCTGAGCGACTTTAGGCGCTGCTTCAACCACTTTGATCGTAAACGTCTTAGGCGATTGGACCTCTCGGAGTTTAAGGCCTGTCTGGTCTCACTCGGATTTCACATCCCCAATACGCCGGAGGGAGACGCCGATTTTCGTCGAATACTCGCTAACGTTGATCCCTCGGGCTCAGGTTATGTCACCTTCGATTCCTTCATGCGTTTCATGACTCAACAAGCCTCAGGTTCGGAGAGCGCGGAACAACTGATCGACTCTTTCCGTGTGCTAGCCAATGAACAGCCCTTCGTAACAGCGGAGACTATTCGTCGCGAGTTACCATTCGAACAGGCGGAGTACTGCCTGCAGAAGATGAAGCCCTACAGTGGTAAAGGTGCGGTTCCCGGCGCTCTCGATTATAGTGACTTTTCCAACAAAATCTTCGGTGAGACCGACCTTTAG

>Scaffold00052.gene4267
MTLGMIWTIILRFCIQDITVEELHAKEGLLLWCQRKTAPYSNVNVQNFHTSWKDGLAFCALIHRHRPELIDYAKLSKENPIQNLNYAFDVAEKYLDIPKMLDAEDMVNTIRPDERSVMTYVAAYYHAFANANNTESAANKIAKVLRSNQDTEKLMEEYAGLASDLLKWISNQIPFLADKTTDGTLPHAKEKLAQYTVYRGSAKLPRVEDKALLEALCNTIQARLKLAHKPAFMPPAGQSIGEINDAWKRMEDTEKGFEDWLLNEIRRLEQLDYLIKKFKLKCSTHEAWSKDKEATLSARDYENASYAELIAMAQKQNAFETDLGAHQNRVEKIVSIAEELKYDLSQNSLRSAFSALQYEDVTNVNKRTQDIVSQWDRLGEISARRKEEIESFSNWLEQAEEDLRDMFIADRVEEVSQLINGHEAFKRALPAAQEELNSMLCEAAEIDRLIEQNDLPHEVAINPYTMFTYETLHDRWGCVQKLVPERDSALESELAKQQSNERMRAQFAMQANRLGPWLERALDALFAAQSNPATAQLEQQMGAFKRMEEELEKIKPIIMEAERCYQQLQENGVYTVPQTQYTMDTLRLGWEQFLTNLKRAINEVEVQIMTSEAHNISEAQLSDFRRCFNHFDRKRLRRLDLSEFKACLVSLGFHIPNTPEGDADFRRILANVDPSGSGYVTFDSFMRFMTQQASGSESAEQLIDSFRVLANEQPFVTAETIRRELPFEQAEYCLQKMKPYSGKGAVPGALDYSDFSNKIFGETDL*