Search results


Species: Taenia solium
Id: Scaffold00052.gene4250
Length: 4077
Strand: -
Start: 134053
Stop: 146843
Annotation: K00923 IPR001263|IPR000403|IPR002420|IPR008973|IPR011009|IPR015433|IPR016024|IPR000341|IPR018936 GO:0016773|GO:0005942|GO:0016303|GO:0046854|GO:0048015|GO:0004428|GO:0016772|GO:0005515|GO:0005488 C4QLW0
Function: Phosphoinositide 3-kinase, accessory (PIK) domain|Phosphatidylinositol 3-/4-kinase, catalytic|Phosphoinositide 3-kinase, C2|C2 calcium/lipid-binding domain, CaLB|Protein kinase-like domain|Phosphatidylinositol Kinase|Armadillo-type fold|Phosphoinositide 3-kinase, ras-binding|Phosphatidylinositol 3/4-kinase, conserved site
Scaffold: Scaffold00052
Sequence:
>Scaffold00052.gene4250
ATGTCCAGCTACTCTGACGATCTCATTGCGTTTACGGATTCGGAACACGTGCGCATGGATTCTCCGAAAACAAGCGTCCTTGCAGAATTCGACCCCCTTTTTGATCTGAAAGGGAAAGATAAAGCATTTTCGCAAACTTTACGCCAGCCTCCCATACGAATTTTGCAGCGCGATCAGTCGGTGGAATCCAATCAGTCCGCGGATCAGCGTTATCAAAATTGTAATAATAGACTTGGTGGCATATTTGACAAAGATGTGATTTGGGGCGAGTTAGAGGAGTATGCGTTGTCTGATAAAGCAGTCAACAAGAATAATCTTTCACATTCTTCTACCTTACCAAATCTCACAACTCTTCGATCAGCCCTGATTTCAGAGACGACACCGCAACAGACACCTCAGGACTTGCTTCTCCTTCATGCCAATATCGCCGTTGATACGAGTCTCCTGAATTTTGCTAAGGCTGTTGAAAACTGTACACCATGGCTGCCTGGAACGAAGAATACGTTTCCCACTCCTTCCTCCACGTGCTTGCAAAGACTACCACCACTTCAACCTCCGGTCTCCTTCAATGCCTACATCTTCGATGCTATTCATGGAAGTGTTTCAAGCTACTGTCTTCGATATAATGCTAAGGAAACTCTACACGATGATTGGCATATAAATCCTGGCCTCCTGGCTATCGCTGATCGAGCCCCACAGACTGCTTTTATTGCTGTGCCCGGGCCAGATGGATTGGATAATGTCAACCTCAAAATCTACATTCCAATGGCCGCCTACTTCTGCAACCGCTATACTGACAGCGTGCGTAATTGGTTGATGGAAAAGTTCCAAACCAACTGCGAACCCACAAAGGTAGTCTCTACACTGGCAAAAGAATGTCTTGAACGAGCCTACGGTACAGACAAACCCCTCAAATCCTTCGCGTACTGCCTAAGAATATGCGGACGCACTGACCTCCTGCATCCACATGCTCGGCTTTGTGATCATGAGTATATTCGGGACTGCTGTCGAACGGGAGCAACTGCGCGTTTGGTTTTGGAAGCCTTCAGTGCACAGGAGTACTTCCTTCCCTCGGTTGAAGACAAGGCTTTGAAACTGAATCTTCACGAGGCCTATGCTGGTGAGACTCGTATTCCTGACAGAGCAACCATCGAAAATTCGATGATGAAAATAAATGGTCACATAGCAAACCTCCGGAAACAGGTTTCCAACCTTTCTTTCAACACTATTAATGCCGCAGGTCACACCTGCGAGATGATTCGAAAGGCAGTAGTCGAGCACATTTCGGGGATCTGTCATGGTACGGCAATCAACACCCTGCCCGAGGCTATGGCGGGCGTACAAAATAGTCTCTACAACCTAATGCTAAGCAGAAAACCTCGGAAACAGACAATCTTCCACCCCAATCTCCCATCCCCAAGAGATAAAACGGGAGCAAATGAGGAGGAATTGGTAAAGGAGAAGCTGACCATTTTGGAGATGCAAGTTATTAGACAGACGATAGCCTTTCTGAAGTGGAAACAGGCTTGGTATCCAGAATTGCGGATGACCTCGGTTCTTTCCGCTCCACCGGTGGGAAGTGAGATGGAGTGCGAACGCCTTCTAGGCTGTCACATGTCGGTGAATAGAGAGTCCCATCGCATGTCAAAGTGTGATATGCCCTTTGTCATGCGGATTGGCAGCGTTATCGATCCCACTGATCACACAGACCCCTGGAATCTCTCTGATCGTTTAGGCGTCGGCAGTTGTGTTAGGGTTCACGTGACTCTGACTTACGCCGGACGGCCGTTATCCACTGTTTACTCATCACCCCTAAGCCCGGCTTATCCGAAAAGTTTTAAAGGGTGCGTGGAATACGCCTGCACCACACCAGTTCTTCGCGACTTCCACTACTCCCGTAAGGTCGATTTTAACTCGGGTGGAAAGATCGACGAATGGATTCGTTTTTTGGATTTCCCATTTCGACGTCTGCCAAGAGAAACTCTTCTCAACGTTAGTCTCATTGCTTTGAAGAAGCAAACTGAGGATCCCGCTATACTGAGCAATGGGACCCTTCTTGGTTGGGTAAACGTGCCCATATTCGACGGCAATGGACGTCTACGACAAGAGGTTGTTCTTGCCGGTCTCTGGCCCCCGGTGGCGGAGGGCCTCTCTCCAGAGTTTAGATCCACCTTTGCAGAGCCCAATCGAAGTCACACCGCTATTGTTGTGGAATTAGAATTCCCCATCTATCCAACCGACTTCTTCTTTCCCAAACCGCCGACTGCAGATGACCTCGATGTCTGTCAAGCGACCATATCCGATGTGGAAAGACGTCATTACAGTGAGTTAGCCAGTCAAATTCTCTACACACCAGCCTCACAATTTCCACCGGCTGGACGTCGATCGACAGAAGCGATTGGAGAGCCCAAGTTCACCACCTTCTTGGCGGATTTGAGTCCACATCAGTTGTTTATAGACCAACTTTGGCAACACCGTCATCGGCTTGTCGCTTCATCGGAACTCCTAACAACTCTCGTTGTTGCAGCTCCTGTCTGTTGGCCGGAAGCCTGTCGACGCGCCTCGCAACTAGGCACAAAAAGTGCTCACGACAGAATTTTGTGGATGCTTTTGCTTTCTCAGCTCTATAGCCTGATTCAACTTACATCACCGCTTTCACCAGCAGCTGCATTGCGTCTTCTGCTGCCCGATGTTCCAGACCAATTTTTTCGGCATTGGGCAGTCTGTTGCATATCCCAATTTCCTCCAGATGGTCTAATCTGTTACCTTCCCTGTCTTCTGGAGGCCGTTAATTATGACCTCCACTTAGATTGGTCGGGCATAGATCTCTTTTACGCCCCAAAACATCACCTCTGTAGGAACATCGAGAGTATTCTAATGAACCCCAAGTGGTATAGTCAACGTCGATTACTTCTGCTGAAGACGGCGATTGTGTGGTTGCATGGCAGTCGTCTAAAAGCCACATGGAGTCTACAAGCAGACGTGTTGTCCCGCATGCGTCAAACCGCTGAAGCTGTAAAAGCAGCCAAGGACAAAACAAAGTGTCGGGCATTGCAAGAGGGTCTGGACTCTATACAAACCTTCCTCGACTCCCGATTTAAGCCCAAGGCCTTGGAGGAGAGTGTATCAACACCCTCAAACGGTTGTTCGCCATTACCACCGAATGCATCAGATCTCCCAACTCCGGATGCCTTCCGCCTACCCTATGATTTTGGCTTCGCGTGTCGAAGTTTTAAGGCAGAGGCATGCACATACATCACCTCTTTCACGTGCCCAATCCGCCTCACCCTAAGTGGAATTGATGGAGAAATGTGCAGCTGTATCTTCAAGGTTGGTGACGATTTGCAGATGGACCTCCTGATTTGCCAATTGATTCACGTAGCGGACAGAATTTGGCTGAATGGGGGAATGGATTTGTGCATTCCACACTTTACAGTGATGCCTACGGAGCCAAAGCGTGGGCTCATTGAGCCAGTACCACATTCTGAGACACTCAGACTAATCAACCAAAACAGTGCTTCAAATCCACGCTTCAAACGCGATCAGGGACTGTTGATGTGGCTTCGAGAAAACCATTCGGACACGAAAGCTCTTCGAAAGGCAGTCGACAACTTCTTCCACTCCACAGTTGCCGGCTCTGTGTTAACCTTCGTGCTGGGCCTGGGAGATCGTCACAACGACAACATCATGATGCGGGGAAATGGCCAAAGCTTTCACATCGACTTTGCCAAAGTCTTTGGCAACTTTCAGAAGATTCTCAGTTTCAATCGTGATCGATCGCCCTTCATTCTCACTCCGGATATGGTGGAGGTGGTAAAATTTGCTGAACCGCCGTCTTCGACATTGAGCAGAATAGAAGACATGCCAAAGGAACTGGTTGACATTCCCTCCTTTGTGCGCCACTGTTGTCAGGCCTACAACCTCCTTCGAAAATATGCCATTTCAATCATGGGCCTCATGGAGATGGCTTGGCAAATGCAATTGCCCGGATTGGAGCGTGGACAAATCGGACATGTCTATGGAAATCTTCGTCGATCCATTAGTGATGCCGAAGCGGAGACCTTTTTCAAAGAGTAG

>Scaffold00052.gene4250
MSSYSDDLIAFTDSEHVRMDSPKTSVLAEFDPLFDLKGKDKAFSQTLRQPPIRILQRDQSVESNQSADQRYQNCNNRLGGIFDKDVIWGELEEYALSDKAVNKNNLSHSSTLPNLTTLRSALISETTPQQTPQDLLLLHANIAVDTSLLNFAKAVENCTPWLPGTKNTFPTPSSTCLQRLPPLQPPVSFNAYIFDAIHGSVSSYCLRYNAKETLHDDWHINPGLLAIADRAPQTAFIAVPGPDGLDNVNLKIYIPMAAYFCNRYTDSVRNWLMEKFQTNCEPTKVVSTLAKECLERAYGTDKPLKSFAYCLRICGRTDLLHPHARLCDHEYIRDCCRTGATARLVLEAFSAQEYFLPSVEDKALKLNLHEAYAGETRIPDRATIENSMMKINGHIANLRKQVSNLSFNTINAAGHTCEMIRKAVVEHISGICHGTAINTLPEAMAGVQNSLYNLMLSRKPRKQTIFHPNLPSPRDKTGANEEELVKEKLTILEMQVIRQTIAFLKWKQAWYPELRMTSVLSAPPVGSEMECERLLGCHMSVNRESHRMSKCDMPFVMRIGSVIDPTDHTDPWNLSDRLGVGSCVRVHVTLTYAGRPLSTVYSSPLSPAYPKSFKGCVEYACTTPVLRDFHYSRKVDFNSGGKIDEWIRFLDFPFRRLPRETLLNVSLIALKKQTEDPAILSNGTLLGWVNVPIFDGNGRLRQEVVLAGLWPPVAEGLSPEFRSTFAEPNRSHTAIVVELEFPIYPTDFFFPKPPTADDLDVCQATISDVERRHYSELASQILYTPASQFPPAGRRSTEAIGEPKFTTFLADLSPHQLFIDQLWQHRHRLVASSELLTTLVVAAPVCWPEACRRASQLGTKSAHDRILWMLLLSQLYSLIQLTSPLSPAAALRLLLPDVPDQFFRHWAVCCISQFPPDGLICYLPCLLEAVNYDLHLDWSGIDLFYAPKHHLCRNIESILMNPKWYSQRRLLLLKTAIVWLHGSRLKATWSLQADVLSRMRQTAEAVKAAKDKTKCRALQEGLDSIQTFLDSRFKPKALEESVSTPSNGCSPLPPNASDLPTPDAFRLPYDFGFACRSFKAEACTYITSFTCPIRLTLSGIDGEMCSCIFKVGDDLQMDLLICQLIHVADRIWLNGGMDLCIPHFTVMPTEPKRGLIEPVPHSETLRLINQNSASNPRFKRDQGLLMWLRENHSDTKALRKAVDNFFHSTVAGSVLTFVLGLGDRHNDNIMMRGNGQSFHIDFAKVFGNFQKILSFNRDRSPFILTPDMVEVVKFAEPPSSTLSRIEDMPKELVDIPSFVRHCCQAYNLLRKYAISIMGLMEMAWQMQLPGLERGQIGHVYGNLRRSISDAEAETFFKE*