Search results


Species: Taenia solium
Id: Scaffold00026.gene2834
Length: 1440
Strand: -
Start: 617551
Stop: 627762
Annotation: K05315 IPR005450|IPR005821|IPR002077 GO:0005216|GO:0006811|GO:0016020|GO:0055085|GO:0005245|GO:0006816|GO:0016021|GO:0051925|GO:0005891 Q963L7
Function: Voltage-dependent calcium channel, L-type, alpha-1S subunit|Ion transport|Voltage-dependent calcium channel, alpha-1 subunit
Scaffold: Scaffold00026
Sequence:
>Scaffold00026.gene2834
ATGATGGACAACCCACGGCCTTGTTCTAACAGCTCCTACTCTATGGCTTTCAATTGCTCCGAGATTGGACCCAACTACGTGTGTCGGGATTTGCCACCAGAGTTGGGCGAACGCTATGTGGGGCCCGAGGATGGTTTGGTGAATTTTGACAACTTTCTCTACGCCATGCTCACTGTTTTCACCTGTGTCACCATGGAGGGTTGGACCACCGTTGGCGCCTACATAGCCGCTGCAGTCGGCCATTGGTGGCCATGGATATACTTTGTCAGTCTCATTCTCCTGGGCTCCTTTTTTGTCATGAACCTCGTTCTCGGTGTCTTGAGTGGAGAATTTACCAAAGAAAAGGATAAGACGGATCGGAAGGAATTGTTCCGAAAGGAGCGCCAGCAAAAGAGGGAACAGCAGGACTACGAAAATTACAAGGAGTGGATTGAAATTGCAGAGGATCTTTCTGAATCAGAGGCCGACGCAAAAAGCAACAAGGAATTGGAATCTGGTCTTATGGACGGAAAAATTGTGGAGGATCAAGAGACGATAAACGAACCAACTGCCAGATCTCAGTGCTGCGAAGGAATGCGACGGTTAAAGAAATTTCGAAAACGCCTTCGACGGGTAATAATAGCGTTTGTAAAGAGTCGCCAATTCTTTGCTCTCATCCTCACCTTTGTGTTTCTCAATACCATTGTTCTGGTCACTGAACATCACAACCAACCACTCTGGCTCAATCAATTTCAGAATTTCGCCAATGTGTTGTTTGTGAGCCTCTTCACTCTGGAAATGATCATCAAGATGTGCGCCTATGGTATTCAGGACTACTTCGCAACTCTCTTCAACCGCTACGATTTTTTTGTCGTTGTTGCCTCCATTCTGGAGATTATCCTCACCTATCTAGGTGTCATCGACCCTATGGGGCTCTCGGTGTTGCGTTGTGCTCGCCTCTTGCGCATCTTCAAAATCACCCATTACTGGGCTGGTCTACGCGGTCTGGTGAATCGCCTACTAAAATCAATAAAGTCGGTTGCTGGCCTGCTGCTTCTCCTCTTCCTCTTCATTCTCATCTGCTCCCTTTTGGGTATGCAGTGGTTTGGTGGCACCTTCAATTTCCCCAACACTGACAAACCCAGAAGTCACTTTGATGGCATCGCCCAGTCCATGATCACTGTTTTCCAGATGCTGACTGGTGAGGATTGGAACGCGGTGATGTACAATGGGATGCGGGCCTACAAAGCCGATGGTCCTTTGTTCGGTTTCGTGGTTATTTACTTCGTCATTGTCTTCGTTGTTGGAAACTACATTCTCCTGAACGTCTTTTTGGCTATCGCTGTGGATAATCTAAGCGACGAGGACGAGTATGATGAAGAAGGTGGGACGGATGACGACAACGACGTTGACGATCATCCTGGATCTTCCGCAGCTGTCAAGAAAGCTGCTGAAGCGTAA

>Scaffold00026.gene2834
MMDNPRPCSNSSYSMAFNCSEIGPNYVCRDLPPELGERYVGPEDGLVNFDNFLYAMLTVFTCVTMEGWTTVGAYIAAAVGHWWPWIYFVSLILLGSFFVMNLVLGVLSGEFTKEKDKTDRKELFRKERQQKREQQDYENYKEWIEIAEDLSESEADAKSNKELESGLMDGKIVEDQETINEPTARSQCCEGMRRLKKFRKRLRRVIIAFVKSRQFFALILTFVFLNTIVLVTEHHNQPLWLNQFQNFANVLFVSLFTLEMIIKMCAYGIQDYFATLFNRYDFFVVVASILEIILTYLGVIDPMGLSVLRCARLLRIFKITHYWAGLRGLVNRLLKSIKSVAGLLLLLFLFILICSLLGMQWFGGTFNFPNTDKPRSHFDGIAQSMITVFQMLTGEDWNAVMYNGMRAYKADGPLFGFVVIYFVIVFVVGNYILLNVFLAIAVDNLSDEDEYDEEGGTDDDNDVDDHPGSSAAVKKAAEA*