Search results


Species: Taenia solium
Id: Scaffold00022.gene2477
Length: 2772
Strand: -
Start: 433107
Stop: 457688
Annotation: K13338 IPR013783|IPR002290|IPR003599|IPR008266|IPR020635|IPR001245|IPR011009 GO:0004672|GO:0006468|GO:0004713|GO:0016772|GO:0004674|GO:0005524 D2YZ89
Function: Immunoglobulin-like fold|Serine/threonine-protein kinase, catalytic domain|Immunoglobulin subtype|Tyrosine-protein kinase, active site|Tyrosine-protein kinase, catalytic domain|Serine-threonine/tyrosine-protein kinase|Protein kinase-like domain
Scaffold: Scaffold00022
Sequence:
>Scaffold00022.gene2477
ATGTGCTGCCAACTTTTCTTTTTGACGACATTATTTTTTATCAAAATTTGTCATATTGTCGCCCATCCCGTATATGTATCGATTGGTGAAAAGGCGGTTTTGGATTTCATTTTTTCGCATTCTTCGAAGACTTCAGCAGTCATTGTACAGTGGACGTTTTTACCCTTCCCCTCGTCCATACCGAAAGGTGAAAATATAGAAAACGGTTTCCACCTGAATACCAGCTATGACGCCTCCAGGTACAAAAATGACATATCCCAAGTGGTCTGTCCGGAGAACCTGATCGGTCCACCCGAACGCACTTGCCGGTTAGCGCGTCTCACCATCAGCCACGTTATTCCCGCCGATGAGGGAATCTACCGCGTTCGCATTGTTGAGACCAACACCACAAATGCCGACTGCTCTCCCTGTATTGGCGAGCTGAACCTCCGTGTCTTTGTTAATGAAAATGGTGCTGGACGACCAATGAGTGGCGACCTATTGGACGGCATGATTCCATCTGGAGATTTCATGGGCTCAAATGATATTCCGATCTACTTCTACGCGCCACCCTTCTCCCTCGACTTCAACATGAACAGCACAGTGTGTGTGGGACAAAATTTTGAATTCCAATGCCGTGCGGAGCCTACCAATTATGGCATCAATTTAACCCTTTACCGACTGGATCCACTCTTCACACTTTCCAGTCTTGAGGCTGCAAATAACCATGGAATGGGCATCGACTTCAGGAATACCAGTACTCGGGTTATGCAGACATCCACAGGGAGGAAGGCCAAGAGTCGACATCTGAAGTGCAAGCTCCACTCGGTCAGTGTGAACGACACTGGAGGCTACCTCTGTGTGGCTTCTGTGCCCAACATGCACGCGGCCCGATGGAGTTACATGTTCCTGCAGGTGGAGGATTGTACCAGTCTCAGCGCTGTAGCATCAACAAGGCCCTTCCAAGAACGCGCTTTGGAGGTGTTTACGAGCCCTTCAGCCCTCACCTTCATCTGTCTCCTACTAGCGATTCTTCTTGTGACTCTGACAGCCCTTGTAATTCTCTCCTGGCGTCGACAGCGGCTTTCACTCTTCCTGTTCGGGTCCAAAAAGTGGAGCAAAGCGGCAAACAAGGTGGTGAGGGAGACCAACCTACTGTATCCGTGGGCTGCACCTCCCTATCACAATTGCTCCCATCAGTTAGCCAAGGATGCTACCAACGGTTCAACCGCCTCCTACGTCGGAATACGATCCAGTGGCATGTGCTCCAGGGTGGGAAGAAATCTTCAGGTGCCAGCAGTGATAATTCAAGTGGACGCCTCAGTCACTGCAGGAGGTGGCGGTGGTGACGGTGGTGGAGGCGGTGAGAATGATGGTGAAGTGGGTGGCAAACCAAGCGCCTATAAGATCCCCAGTGATCCCGCCTGGGAGGTGCCACGGGACTGCGTGCGTCTTGGTCGTCAAATTGGGGCCGGTGCCTTTGGAGTGGTCTTTGCGGGCGTGATTAGTGAGCCTGCCAAGGTGCTGCCTGGAGTGCGTCGCGGCAACCCCCTCGATCGGCCTCTTTGCAGCGCGCAAGAGCTCACTGTCGCTGTGAAAACACTTCGCAACAATTTCACTGAGCAGGAATTGGCAGACCTGGTTCGCGAAATGGAAATTCTCAAGCAATTTGAACCGCACCCCCATGTCATCCAACTCTACGGTGCCTGCACACAAAATGGCCGGCTACAGATGTTGGTTGAGTTGGCGCCGTATGGGAACCTTCGTGACTTTCTCATGGACCGCAGGCCATGTGCTGGGCAGAAAGTGATAAATCAGCCCCTCTCTCGACTCTCCACCAGGCATCTTGTCAGCTTTGGGTTGCAAGTTGCACGGGGTATGGACTACCTCACTAGGCTGAATATTGTCCATCGTGACCTAGCGGCTCGCAATATCCTCATTGGCAACAGATTCGTGGCTAAAATAGCGGATTTTGGACTAACAAGAGCCGTCTGTGACTACTACAGGAAATGTAGTGACGGAAGACTGCCGATCAAGTGGATGGCTCCTGAATCCATATTTGATCGTCGATATACCGCCAAAAGTGATGTCTGGTCCTTTGGAATTCTTCTGTGGGAAATCTTCTCCTTCGGCGGAACGCCTTATCCGACCCTTTCGGCAGAGGCACTCTTAAAGGCCCTTCAGTTGGGCTTTCGGAATGAGCAGCCACTCGCCTCACCTGCCTCCGTCTACAATCTCATGCTTGCTTGTTGGTCTATCGACCCGGCAGCCAGACCCTCCTTCGCCCATCTCGTATCCTCCCTCCAGCAAGTCTACGATGACACCACTGCTGCTGCCCACGAGCACGCTTCCTCGGCCTCGATGTCATCGGCGTCTTCATCGTCTCTGTCGTCCACTGCTTCATCATCCTCTTCCCGGTCCTCCTCTCCCACAGTCTCCACCGTCTACTTGACCTTAAACAACACCATCACCAACGTCAATAACGGCAACAACAACGAGGGTCTGCATAATTACAACAATCAGAGCGCACACGTCAGCACTGTCAGCCCTCCGATTTCCTCGTCGATCTATCAATCGACTGTGCCGCGAGCGTCTCTGATGGAGCAGTGTCCATCCTCCTCTCTCTCAGGGAATTTCCAAGGTCATCAGGGACATCTGGGGCCACCGACAGGTGCGGGAAGCAATGTGCTTGTGAATAATTGCTACGCTGAACGGGGGCAGTATCTGCAGAGCATACACAAGGCGTTCTCCATGCATAGCAATTATGTTGTGCCCCCACGATCCAACGAGTAA

>Scaffold00022.gene2477
MCCQLFFLTTLFFIKICHIVAHPVYVSIGEKAVLDFIFSHSSKTSAVIVQWTFLPFPSSIPKGENIENGFHLNTSYDASRYKNDISQVVCPENLIGPPERTCRLARLTISHVIPADEGIYRVRIVETNTTNADCSPCIGELNLRVFVNENGAGRPMSGDLLDGMIPSGDFMGSNDIPIYFYAPPFSLDFNMNSTVCVGQNFEFQCRAEPTNYGINLTLYRLDPLFTLSSLEAANNHGMGIDFRNTSTRVMQTSTGRKAKSRHLKCKLHSVSVNDTGGYLCVASVPNMHAARWSYMFLQVEDCTSLSAVASTRPFQERALEVFTSPSALTFICLLLAILLVTLTALVILSWRRQRLSLFLFGSKKWSKAANKVVRETNLLYPWAAPPYHNCSHQLAKDATNGSTASYVGIRSSGMCSRVGRNLQVPAVIIQVDASVTAGGGGGDGGGGGENDGEVGGKPSAYKIPSDPAWEVPRDCVRLGRQIGAGAFGVVFAGVISEPAKVLPGVRRGNPLDRPLCSAQELTVAVKTLRNNFTEQELADLVREMEILKQFEPHPHVIQLYGACTQNGRLQMLVELAPYGNLRDFLMDRRPCAGQKVINQPLSRLSTRHLVSFGLQVARGMDYLTRLNIVHRDLAARNILIGNRFVAKIADFGLTRAVCDYYRKCSDGRLPIKWMAPESIFDRRYTAKSDVWSFGILLWEIFSFGGTPYPTLSAEALLKALQLGFRNEQPLASPASVYNLMLACWSIDPAARPSFAHLVSSLQQVYDDTTAAAHEHASSASMSSASSSSLSSTASSSSSRSSSPTVSTVYLTLNNTITNVNNGNNNEGLHNYNNQSAHVSTVSPPISSSIYQSTVPRASLMEQCPSSSLSGNFQGHQGHLGPPTGAGSNVLVNNCYAERGQYLQSIHKAFSMHSNYVVPPRSNE*