Search results


Species: Taenia solium
Id: Scaffold00014.gene1785
Length: 810
Strand: -
Start: 243069
Stop: 246057
Annotation: K03135 IPR006809|IPR009072 GO:0005634|GO:0006367|GO:0003677 C4Q3I3
Function: TAFII28-like protein|Histone-fold
Scaffold: Scaffold00014
Sequence:
>Scaffold00014.gene1785
ATGGCTCCTAATTCTAATATTTGCTTTGTGATTTTGTGGTGGCTGATGGGTACGATTTCTTCTCCCCTTAAAAGGGAGCTTCTCGAAGGTGCATCATTAAACAGTGACCCCTCTCCGAAGGAACTATCATTTCAGGGCATTTCCAATAAATCCATTCTAACCACTCCGGAGAAACGCATGAAACTGGAGTCCACGGGGTTATATGTGGAGGAAGGCAGCTCCGAGGTGATGGCCACGGAAGACGACGAAGTGGAAGAGGAGGAGGTCGAGGAATTGTTCGGTGACGACGAGGAAGACGAGGAGGAGGGGGAATTGGAGTTAGAGGAGGAAGTTGATGAAGAGGACGACGAAGAGCAGGACGAGACGGAGCGTCTTGCAGAGGTTCTCGGTGTAGAGGTTTTCGAGCGGGGCAGTGGCGCGAGCAGTAACGCCGATCGGCGCATCACCACCGCTGACCAGCAGGAGGAGACTAATCGGGCTGAAGACAGAAAATTGCTCGCTCTCATGGCTCACTTCAATGACGATCAATTGAGTCGGTTCGAGTCCTACAGACGCGCCACTTTTACTAAATCTGCTGTTAGTCGGCTCATCCAGTCGGTGGCACAAACTTCATTTTCCCAGAACGTTGTTATTGCAATGGCTGGAATTACAAAGGTTTTTGTAGGTGAATTGGTCGAAACAGCACTTGACTATAAAGAAGAACTGCAGGAAACCGGACCTTTGCAACCAAAGCACATTCGAGTGGCTTACGCCCGGTTAAATGCACAGGAGCGTACATCGCGACAAAGTCGTCCAAACCCGCTGCTGTGA

>Scaffold00014.gene1785
MAPNSNICFVILWWLMGTISSPLKRELLEGASLNSDPSPKELSFQGISNKSILTTPEKRMKLESTGLYVEEGSSEVMATEDDEVEEEEVEELFGDDEEDEEEGELELEEEVDEEDDEEQDETERLAEVLGVEVFERGSGASSNADRRITTADQQEETNRAEDRKLLALMAHFNDDQLSRFESYRRATFTKSAVSRLIQSVAQTSFSQNVVIAMAGITKVFVGELVETALDYKEELQETGPLQPKHIRVAYARLNAQERTSRQSRPNPLL*