Search results


Species: Taenia solium
Id: Scaffold00012.gene1643
Length: 1476
Strand: -
Start: 1075285
Stop: 1076760
Annotation: K05051 IPR000276 GO:0007186|GO:0016021 C4PX91
Function: GPCR, rhodopsin-like, 7TM
Scaffold: Scaffold00012
Sequence:
>Scaffold00012.gene1643
ATGGTAACTCAGCCAATCAGAAGCGAGTTTAGCAATGAGGTCGCTATACTAAACTTCATCCGTCTTTGCAATTTCCGTTGCACATGGAATGACCTCTGTATCGAAATGGAGACCCTGACCACCCACCGCATTACGACGATGAACAACACTCCCAGCAATAGCGCCATTTTTAGTGATGTCGAAATATTCCGTGCCATCGCTGTGATGGCCGCGGTCATGGTGATTGGAAGCATCGGTAATACACTTGTGATTTCAGTGCTTTGCCTTAAAAACTTCTCCTCCAACAGCCGGTGGAATCAGTACCGACGGCGAAACCAATCCAGCCTCTCCGAGAATAGCGAAACTGGCGCTTTCGGTAGAGACAAAACTCTAGACTTTTTTATTCTTGTTCTGGCTGTCTCTGATCTCTTGGTTTGTATTATCATCATCCCAGCCACCATCACCATGGAGATCCACCAGTTCCGTATCAGCATCGATGGTCTCTGTAAACTCTTCTACGTCCTTTTCGTCACCAACACCACCTTCTCTTCCCTGCTCATCTCCGCAGTGGCGCTCGATCGGTACCTCTTTATTTGCCACTCACTGAAGCATATTCTCACCCTGCTTCGAGCAAAGATTCTTGTCTCCACGCTGGCTCTATTCTCCCTCTGTGTGGGTATTGCTGCAGGCTGTGTGGTGGGTGTCAAGGCTATGCATTCCAATACAACAGAGGACGGTGCTCAAACCAGCTACATCTGCGAGGAGAACGAATACGTACGAGGGATTAGTGAACTTCAAAAGACTGTTTCGCAAATCATCAAGTACCTTAACCACGCTTGCTATCTGGCCTGCATTCTTATTGTCCTCATTCTCTACTCTTGTGTCTTCTGGGCTATTGTTACCTCACGATCTCGTAGTCACAAACTCACCGTGTCCTCTCAGACAAAGCGGCAAAATGGGCGCAGCTCTGCCTATCCAGAGGAACCCACTACCAATTCAAGACTATCCCGACAACGGATGGCCAACCTACCGGCCAAGTTGCGACAAAAGGCCCAATTTACCCTACAAAATCTCCGCTCTGCACTCATGCTCTTCATCATTGCTCTCGTCTACATTTTAACTTTCGTCCCCTCTCTGGTGATAGCAAACGGTTGGGCACCACAGAATTTAGTACTCCTCTATCTCTACTATGTAAACAGTGCCGCCAACCCCTGCATCTATGCCATCTTCACACCCTCCTTCCGTCAGATAGTCGCTTTACTCTTCCGCAACTGCTTCTGCAAGAACAGCAGCACGCATCTCCCCACCAGTGGAAGAAATTCAAAGCGCTCGGATCACATTGCCACCATTAACGCCGGTGTCTCCCACACCAACAATCGGGCCTTTAGCCACATGAACAAAAAGAAACGGGCAGTTAAGGAGGCCTATCCCTTTATATCAAGAGAGGAACGAATGGCTGCAGCCGCTGCAGCTGCTGCTGCCGCCCAACAGCGGTGA

>Scaffold00012.gene1643
MVTQPIRSEFSNEVAILNFIRLCNFRCTWNDLCIEMETLTTHRITTMNNTPSNSAIFSDVEIFRAIAVMAAVMVIGSIGNTLVISVLCLKNFSSNSRWNQYRRRNQSSLSENSETGAFGRDKTLDFFILVLAVSDLLVCIIIIPATITMEIHQFRISIDGLCKLFYVLFVTNTTFSSLLISAVALDRYLFICHSLKHILTLLRAKILVSTLALFSLCVGIAAGCVVGVKAMHSNTTEDGAQTSYICEENEYVRGISELQKTVSQIIKYLNHACYLACILIVLILYSCVFWAIVTSRSRSHKLTVSSQTKRQNGRSSAYPEEPTTNSRLSRQRMANLPAKLRQKAQFTLQNLRSALMLFIIALVYILTFVPSLVIANGWAPQNLVLLYLYYVNSAANPCIYAIFTPSFRQIVALLFRNCFCKNSSTHLPTSGRNSKRSDHIATINAGVSHTNNRAFSHMNKKKRAVKEAYPFISREERMAAAAAAAAAAQQR*