Search results


Species: Taenia solium
Id: Scaffold00006.gene988
Length: 3039
Strand: +
Start: 639290
Stop: 661997
Annotation: K05315 IPR005821|IPR003091 GO:0005216|GO:0006811|GO:0016020|GO:0055085|GO:0005249|GO:0006813|GO:0008076 Q963L6
Function: Ion transport|Voltage-dependent potassium channel
Scaffold: Scaffold00006
Sequence:
>Scaffold00006.gene988
ATGGACTGGATTCAACATGCAGAGGAAGTAATTCTGGCCGAGGACACGACATCTGCGGAGGACAGGATACGCATCATTGCAGCTCGAAGGCGAGCCCAGAAGGAGCGGAGCAAGAAAAATGTTAAAGATGCACAGGGACAGGAACTAAACTTCGAAGACTCCGACCTCTATTCGGATAACAAGGGTAACGTGTTCAATCAACAGGGCCTTCTTCTCAAACCGGGCAAAGGACGATTCGAAGCCTGTTGGAGAAATGAAAAGCGATTTCGGTACGCAGTTCGGAGGCTAGCTAAGAGCCAGTTGGTGTATTGGAGCGTGATTGTTTTAGTCTTTCTGAACACCATCTGCGTCGCAATTGAACACTACGGTCAGCCTGCCTGGCTTACCAGTTTTTTATATTACGCTGAGTATGTCTTCCTTGGACTTTTCATGACTGAAATGCTTCTCAAAATGTACGGCCTCGGCTTCCGACTCTACTTCCAATCATCGTTCAACATCTTTGACTGTGTCGTTATCATCGGGAGTCTCTTTGAGATTCTCCTTGCCCTTGTTCAGCCGGATACCTCATTTGGCATCAGCGTTTTGCGAGCGCTGCGACTTCTGCGAATTTTTAAGGTCACCAGATACTGGGCGGATTTGAGAAATTTGGTGTTATCTCTACTGAGCTCGATGCGAAGCATCATTTCCCTGGTCTTCCTTCTCTTCCTCTTCATCCTTATCTTCGCTCTCCTTGGAATGCAGCTCTTCGGTGGCGAGTTTAACTTTGAAGAAGGTCTTCCTGCTCAAAACTTCGATTCCTTCGTGAAGGCTCTGCTCACTGTCTTTCAGATTCTGACTGGCGAAGACTGGAACTCAGTCATGTACAATGGGATTCGTTCTCAGGGCGGAACGAACGGAGGCGGATTCATCTATTGCATCTACTTTGTCCTCTTGGTTCTCATAGGAAACTACACCCTGCTAAACGTATTTTTGGCTATTGCCGTGGACAATCTTGCAAATGCACACGATCTCAGTGATGCTGAGCAAGCAGATCAAAATGAGGAGAAATTGAAGGAGGCCAAGGCAAAGGGACTTCAGCCTTCCACGTTGGATCTCACAGATCCCGATAGAGCTCACCTCCTGCCATGGGTACGAACACCCAAAAAGGAGAAAACTAACCTGTGGCAGGAGAACTATCCTGGAGACTCGGCCAATGTGAGCGAAATGACTCTGCAGGTGGGAGATCAAAAGGCAAACGGAAATTTCCTCTCCTCTCCATTCTCCATGCAAGGGAAGGGACAAAATTGTATATCCTTCGAAAGCGACGAGACAGGGCAATTACCGGACTCCGAGAAAGTTGGACATGGAAAACCCGTTCTGCCTTATAGTTCCATGTTCATCTTCGCTCCAACTAATGGGATTCGCCGCTTCTGCCACTTTGTGGTCAATCTTCGCTACTTTGATCTCTTTATTATGATCGTGATTTGCGCCAGCAGTATCGCTCTTGCCGCGGAAGATCCTGTTGCCGAAAACTCCACCAAAAACAAAATCCTCGAGCACTTCGACTATGCTTTTACAGGTGTCTTCACTGTGGAAATGGTCCTTAAGGTGATTGATTTGGGCGTTGTGCTCCACCCGGGTGCTTACTGTCGCGATCCCTGGAACATCCTCGACGCTATCGTTGTCTTCTGTGCTCTAGTGGCGTTTACGATGAACAAACCAGCCACCAGCGCTTCGGCCAAGAACTTGAACACCATTAAGTCGCTCCGGGTGCTTCGTGTCCTCCGTCCTCTGAAGACGATCAAACGAGTGCCCAAACTGAAGGCCGTCTTCGATTGTGTTTTGAGCTCCCTTCGAAATGTTCTCAACATTCTCATTGTTTTCGTGCTCTTCCAATTCATCTTCGCCGTTATTGCCGTGCAACTGTTCCAGGGTAAATTCTTCTACTGCAACGATGCCTCAAAATTAACCAAGGAGGAGTGCCAGGGTCAATTTTTTGACTATAACGCGGATGGTATTCCAACCACGGTCTGGAGGGAATGGAAGTCTCATGGATTCAATTACGACAACGTCTATTACGCAATGCTGACACTATTCACTGTAACCACTGGTGAGGGTTGGCCCGGGGTTCTGAAAAACTCCATGGACGCGACGCATGTAAATAGGGGACCGTTGGAGGATTACCAACAACAAGTGGCAATCTTTTACATCGCCTTCTTCGTTGTGTTTCCCTTCTTCTTCGTCAATATCTTCGTCGCGTTGATCATCATCACCTTCCAAAAGCAGGGAGAAAATGAGCTGATTGATCTGGAGTTGGACAAAAATCAGAAACGTTGCGTGGACTTTGCTATCAATGCTCACCCTCTGTGTCGCTACATGCCAAAGAACAAACGTTCGTGGAAGTATCGCATTTGGCGTCTGGTTGTGTCGACGCCCTTCGAGTACTACATAATGGTGATGATCGCGTTGAACACACTAATCCTCATGATGAAGTATCATCGACAGGAGAGGAGACCTTCTATGGCCACGAATATTGACACGGCTCAGCAAAACTACCACAACTATTGCAACACGCTAATATTTCTAAATTCTGCCTTCACCATCATGTTCTCCGTGGAGTGTGTCCTCAAAATCATGGCGTTTGGACCGAAGAATTACTTTCGTGACAGATGGAACATTTTCGACTTCATCACGGTGATAGGCAGCATCACAGACGTTCTGGTTTCTGAACTGCAGCAATCAGCATTTTTGAGCCTTGGTTTCCTACGACTCTTCCGAGCAGCGCGTCTGATCAAGCTTCTTCGACAGGGCTACACAGTGCGCATCCTCCTGTGGACGTTCATTCAGTCGGTGAAAGCACTGCCCTATGTCTGCCTCCTAATCGTCATTCTTTTCTTCATCTACTGCATCATTGGTATGCAGGTCTTTGGAAACATAAAAAATGATCCAATGACGCAGATGAATAACCACAACAACTTCCAGACTTTTGGCAGCGGTATTCTCCTCCTCTTCAGTGAAGCGGCGGATAATGCCGAGGGAATGATTTGTGCTGTTGGTTGA

>Scaffold00006.gene988
MDWIQHAEEVILAEDTTSAEDRIRIIAARRRAQKERSKKNVKDAQGQELNFEDSDLYSDNKGNVFNQQGLLLKPGKGRFEACWRNEKRFRYAVRRLAKSQLVYWSVIVLVFLNTICVAIEHYGQPAWLTSFLYYAEYVFLGLFMTEMLLKMYGLGFRLYFQSSFNIFDCVVIIGSLFEILLALVQPDTSFGISVLRALRLLRIFKVTRYWADLRNLVLSLLSSMRSIISLVFLLFLFILIFALLGMQLFGGEFNFEEGLPAQNFDSFVKALLTVFQILTGEDWNSVMYNGIRSQGGTNGGGFIYCIYFVLLVLIGNYTLLNVFLAIAVDNLANAHDLSDAEQADQNEEKLKEAKAKGLQPSTLDLTDPDRAHLLPWVRTPKKEKTNLWQENYPGDSANVSEMTLQVGDQKANGNFLSSPFSMQGKGQNCISFESDETGQLPDSEKVGHGKPVLPYSSMFIFAPTNGIRRFCHFVVNLRYFDLFIMIVICASSIALAAEDPVAENSTKNKILEHFDYAFTGVFTVEMVLKVIDLGVVLHPGAYCRDPWNILDAIVVFCALVAFTMNKPATSASAKNLNTIKSLRVLRVLRPLKTIKRVPKLKAVFDCVLSSLRNVLNILIVFVLFQFIFAVIAVQLFQGKFFYCNDASKLTKEECQGQFFDYNADGIPTTVWREWKSHGFNYDNVYYAMLTLFTVTTGEGWPGVLKNSMDATHVNRGPLEDYQQQVAIFYIAFFVVFPFFFVNIFVALIIITFQKQGENELIDLELDKNQKRCVDFAINAHPLCRYMPKNKRSWKYRIWRLVVSTPFEYYIMVMIALNTLILMMKYHRQERRPSMATNIDTAQQNYHNYCNTLIFLNSAFTIMFSVECVLKIMAFGPKNYFRDRWNIFDFITVIGSITDVLVSELQQSAFLSLGFLRLFRAARLIKLLRQGYTVRILLWTFIQSVKALPYVCLLIVILFFIYCIIGMQVFGNIKNDPMTQMNNHNNFQTFGSGILLLFSEAADNAEGMICAVG*