Search results


Species: Taenia solium
Id: Scaffold00004.gene670
Length: 1743
Strand: +
Start: 438726
Stop: 444862
Annotation: K10352 IPR019152 C4QD15
Function: Protein of unknown function DUF2046
Scaffold: Scaffold00004
Sequence:
>Scaffold00004.gene670
ATGGTTGATAGTGCTTCAGAGTTGGATCTAGAGTCCGATGCTAGCTCCATTGATGGTCACACAGGAAGGTGTGAACAATTGCAACGACAAGTAGAGTTGCTGCAACAGCAAAATCGGATGCTTAAAACGGAGGTTGATCAGCTTACCCTGCGAGTGAAAAGTTTGGTCGAAAAGAATGAACAACTCCGAAGAAACAGTGTATCTATTTTGGCGCAGGCTGAGCGGGAGGAGGAATACATAAGTAATACTCTTCAACGTCAAATTTCTGAGTTGAAGAAAGACAAGGAGTCTCTCGTGGTTAAGTTTGAGGAGGAAGAGGAACGACTTATTAATGAGTTAAATCGTAAATTGATGCAGCTGCAAAAAGATAAGGATAAACTTGAGCGAACACTTGCGAAAGAACAAGAAGCTCAGGTAAATAAGCTGAAGCGTCGGATTGAAAGACTTGAAAGTGAAAGTGAGTGGAAACAACAGATTTTGGAGAAGTTGAGGCGTGATAAAATTGAGCTTGAAAATGCTTTGGAGCAGGAACAAGAGGCGCTTGTCAACAGACTTTGGAAAAAGATGAAAAAGCTGGAGGATGAAAAGCGCATTCTTCAGGATAAGCTGGAAAGTGTCAGCGCTCCACCATCGGAGAGTCCGAGCGTGCAAAACATATCTGCGGTGGCGATTGGTGGTGCGAACCAAGCGCAGCACTCAACCTCTATCCCCATGGGTTTTCTGCAAACCAGTCAGCATCGTCACTCAGCAGGCGGTTCCTTGCGCGGTTCTCTGCGCATTCCCACTACGGACGCCCTCGGAAGAGGCAGTTTTGACAGCTTCGAATCGAGTGGATGTCAGTCAGATAACGCTGGACAATCTCCCACTCATTCGGGAGCCAGGGGCTCTCTCACTTCTTCTATCAGTCCGCGTCCACCCCAGAGTCCCATGGAACTTGATGATGCCAGTATGCCAACCGGCAGTCTTGTCCGATCAGATAGCTCTCAGTCCGGAAGTCGTTCACAACGCAATAGTTTTCAGCCAAGCAACACTACAGTAGCTGAGTTGACCACTGAAAGCACAGTTGCCGGAGCCGCGTACGTGGCCAGACTGCGTGAAGAGGTCATTCGTCTACGTCGCATTGTTGCTGTTACCCAGGCTGAGCAAGCTCTTCGTTCAAACCAGGAGCGCTCGGCCATAGACGAGAATGCTCGTCTGCGCCAACTGCTGGAAGTCGAAGTGGATCGCACGAGGGCTCTTACACGAGCCCTCAGCGATAGCGAGTCCAGTCTTGAGATTGAGGACGAACGGTGTTACAACAACGCTAGGCGCCTTGCGGTGTCATCAAATCGTTTGCGCACTACTTCCGACGGCTGCCCCGCATTCTTGGCACAGGGACCCTTTTTGGGTCCGGGCCATGTCTACGCCGCGGCTGTTTTTCAGGGTCGTAACAACTCGGGTCGCGTCTGTCGGGAGTGTGGTCAGCCTCTTCCCCCCGGCAAGATGCCTTATCACGGCGGTGCTGTAACACCCCCGCCCTCATCACCTTCCCCCGGTTCCTTTGTGAAGCCCTCGCCCCATGTTCGGCCTCCGCACTCAATTAGGCAGTCGAGCGCCTCCACTGCAGTCACCACCACCGGTTGTGTTACGTCCACCACAAACGTTCCCACCAGACACTCCGCCAACACCTCTGAAGGGGAGGAGGAGGACGAGGAGGAGGACGACGAGCGCTCTAAGACCCCACCCGCCAGTATGACCGACTGA

>Scaffold00004.gene670
MVDSASELDLESDASSIDGHTGRCEQLQRQVELLQQQNRMLKTEVDQLTLRVKSLVEKNEQLRRNSVSILAQAEREEEYISNTLQRQISELKKDKESLVVKFEEEEERLINELNRKLMQLQKDKDKLERTLAKEQEAQVNKLKRRIERLESESEWKQQILEKLRRDKIELENALEQEQEALVNRLWKKMKKLEDEKRILQDKLESVSAPPSESPSVQNISAVAIGGANQAQHSTSIPMGFLQTSQHRHSAGGSLRGSLRIPTTDALGRGSFDSFESSGCQSDNAGQSPTHSGARGSLTSSISPRPPQSPMELDDASMPTGSLVRSDSSQSGSRSQRNSFQPSNTTVAELTTESTVAGAAYVARLREEVIRLRRIVAVTQAEQALRSNQERSAIDENARLRQLLEVEVDRTRALTRALSDSESSLEIEDERCYNNARRLAVSSNRLRTTSDGCPAFLAQGPFLGPGHVYAAAVFQGRNNSGRVCRECGQPLPPGKMPYHGGAVTPPPSSPSPGSFVKPSPHVRPPHSIRQSSASTAVTTTGCVTSTTNVPTRHSANTSEGEEEDEEEDDERSKTPPASMTD*