Search results


Species: Taenia solium
Id: Scaffold00001.gene101
Length: 1788
Strand: -
Start: 1146886
Stop: 1161892
Annotation: K02649 IPR002219|IPR008936|IPR020454|IPR000198 GO:0005622|GO:0007165|GO:0035556 C4QAI3
Function: Protein kinase C-like, phorbol ester/diacylglycerol binding|Rho GTPase activation protein|Diacylglycerol/phorbol-ester binding|Rho GTPase-activating protein domain
Scaffold: Scaffold00001
Sequence:
>Scaffold00001.gene101
ATGGACAGCCCTCTGGGGCCTACCTTATTCGGGATAGTCAGCGGGCGGATGGAGCCTTCACTTTGGCCATTAGGTAAGGTGATTCAGGAAACTGTTTCTGTCGTTAGATTCGATGACTCAACAAAAAATTATAAATTATTTTACGATTCGACGTCTCAATTGCATTATGTTGGAGAAAAGAAGTTCGAATCAGTTGATCAGCTGGTAGCTGACGGATTAATTTATTTGTACATCGAAACCCGTGGGGCTGACATTTTGCAGAAATTGTCAGAAGCTACCAACTATGAGCACTCGCCCTACTACAAGACACGCTATCATACGGTGAATGCCGTTCCCCCGCCTACCAGGCCTTCAGTCGCCTCCATCAGCAGCACCAATTACCGGCGTCAATCCTCACTCGAACTGCTCGATGGGTCTAAAAAAACTTCAATCCGTCTTACCCAATCAATCCAGAGCGCTGCCGCCGATGAGATTGCCAACGGCGTCATTAACAATCCCACTAAGAAGCCCCCTGCTGTGTTGTCCACATCCGTTGACAAACCTGCCCGTAGCACCTCACTACCATTTTCTAAACCGCGGATTGAACTCTCACTTGGATCACCCACTGCACCGATTGCCAAACCAAACAGCTCCACTGACACCACCGGCGTCGCTCGTAGTAGCACTAGTAGCGGTAGCAGCAGTGGCCACGCTAGCCTAAAGAGTCAGTCGGGGAAGGGGGAAGATGGCGTTGACGATGGTGGTGGTGAGAGCCGCCGTAGAAAGGTGGTTGGCAGTGTCCAACATCACCGCACTCTCGCATCCACCCTGCCGGTGAATCTGGATGGCGCCAACACACATACGCCTGGGCGCATCAGCGGTGAGGTAACGACTGCCTCTCCTACAGCCACGACATCCTCCACCCTCGTGCATGTTGACGTGGAGAAGGCGCATAATTTCCGCGTCCACACCTTCCGGGGACCGCATTGGTGTGATTTCTGCACTCACTTCATCTGGGGCCTTGTCTCACAGGGCGTGAAATGCGCCGATTGCGGTTTTCAGGCTCACAAACGCTGCTCCATAAGCGTTCCCAACGACTGTCTTCCAGATATGAAACGTCTTAAACGCGTCTTCGGTGTAGACCTAACCAGTTTGATTCGTGCCGAAAACAGGACTGTGCCTCAGGTGTTGGTCAAGTGCATCGCCGAATTGGAGCGACGAGGTGGCCTCGTGACGGAAGGGGTCTATAGGGTTCCTGGGAATCAAGAAATCGTCGAGGATTTCCGCATTGCTTTGGATAAGGACTGTGAATCAGTGGATCTCTCGGAGAAGAGATGCAACGATCTGAATACAATTACCAGTCTTATCAAGTCCTTTCTCCGTCAACTACCGATTCCCCTCATCACGTACGAGGCCTATCCCGAACTTATTGACATTGCCCGCGATGAACAACTCTCAGAAGAGCAGAAACACGACCTTCTCAAGGGATGCATCCAACGGCTTCCATTGGCTCACTACTACTGCCTCCGATACCTGATGGCCCATTTGAACAGGGTTGCGGAACACCAGCAAACGAACATGATGTCGTCAGAAAACCTGGCCATCGTGTTCGCGCCCAGCCTGATGAGCTCCTCCTACACAGACCCACTGAGTTGTCTCGCAGGGGCCAAGTTCGAGCAGGCGGTGGTTAATCGACTGATCACGGACTTTCCCACTATCTTTGATGGTGATGATTGTGTGCCCAGCGCGCCCCTCTCCTCCTCCGCCTCCACTACCACTTCTCGCTCGACCACTGCCTCTTTGCGCTGA

>Scaffold00001.gene101
MDSPLGPTLFGIVSGRMEPSLWPLGKVIQETVSVVRFDDSTKNYKLFYDSTSQLHYVGEKKFESVDQLVADGLIYLYIETRGADILQKLSEATNYEHSPYYKTRYHTVNAVPPPTRPSVASISSTNYRRQSSLELLDGSKKTSIRLTQSIQSAAADEIANGVINNPTKKPPAVLSTSVDKPARSTSLPFSKPRIELSLGSPTAPIAKPNSSTDTTGVARSSTSSGSSSGHASLKSQSGKGEDGVDDGGGESRRRKVVGSVQHHRTLASTLPVNLDGANTHTPGRISGEVTTASPTATTSSTLVHVDVEKAHNFRVHTFRGPHWCDFCTHFIWGLVSQGVKCADCGFQAHKRCSISVPNDCLPDMKRLKRVFGVDLTSLIRAENRTVPQVLVKCIAELERRGGLVTEGVYRVPGNQEIVEDFRIALDKDCESVDLSEKRCNDLNTITSLIKSFLRQLPIPLITYEAYPELIDIARDEQLSEEQKHDLLKGCIQRLPLAHYYCLRYLMAHLNRVAEHQQTNMMSSENLAIVFAPSLMSSSYTDPLSCLAGAKFEQAVVNRLITDFPTIFDGDDCVPSAPLSSSASTTTSRSTTASLR*