Search results


Species: Taenia solium
Id: LongOrf.asmbl_8877
Length: 2742
Strand: -
Start: 304703
Stop: 316553
Annotation: K01528 IPR022812|IPR003130|IPR011993|IPR019762|IPR001401|IPR000375|IPR001849 GO:0005525|GO:0003924|GO:0005515 C4Q9B4
Function: Dynamin|Dynamin GTPase effector|Pleckstrin homology-type|Dynamin, GTPase region, conserved site|Dynamin, GTPase domain|Dynamin central domain|Pleckstrin homology domain
Scaffold: Scaffold00037
Sequence:
>LongOrf.asmbl_8877
ATGCCCGGTAATGCGGGCATGGAGCAACTCATACCCCTTGTAAACAAACTCCAGGATGCATTCTCATCTCTTGGAGTACCTCTTAATTTGGATTTGCCGCAAATCGCTGTCGTTGGTAGTCAAAGTGCTGGAAAGAGCAGTGTATTGGAAAACTTTGTAGGAAGAGACTTTTTACCCCGAGGAAGTGGCATTGTAACAAGAAGACCTTTGGTTCTTCAGCTTATTACGTCGGATGCAGAATATGCTGAATTTCTGCATTTAAATGGTGTAAAATTGACAGATTTTGATGAAGTCAGAAAAGAAATTGAGGCGGAAACAGATCGAGAAACCGGGACAAATAAGGGTATATCGAATAAACCTATAAATTTAAAGATATATTCACCTAATGTTCTTAATCTTACTCTGATCGATCTACCCGGAATGACAAAAGTCCCTGTGGGTGACCAGCCTTCGGACATATCCGCTTTAATTGAGGAAATGATTCTTCAGTATATAAACTGTGATTACTGTCTTATACTGGCAGTTTCTCCAGCCAATTCTGATTTGGCGAATTCAGATGCTTTAAAGATTGCTCGGGAGGTTGATCCTCAAGGACTTCGTACCATCGGTGTGATCACGAAGTTAGATCTGATGGATCATGGAACTGACGCACGTGATGTTTTGGAAAATAAGCTCTTGCCTTTGAGAAGAGGTTATATTGGCGTTGTGAACAGGAGCCAGAAGGACATTGAGGGCAGAAAAGATATTACTACAGCTATGGCTGCAGAAAGGAAGTTTTTCCTCAGCCATCCGGCCTACCGCCACATGGCCGATCGCATGGGAACGCCCTACTTACAGCGTGTCCTCAATCAGCAGCTGACTAACCACATTCGCGAAACTTTACCTGGCCTCCGAAACAAGCTTCAGTCACAAATGTTGGCAATGGAAAAGGAAGTTCGGGAATACAAAGCTTATCAGCCTGCTGATCCTTCGTTCAAAACTAAGGCTTTAATGATTGCTGTAAAGAGTTTCGAGGTTGAGTTTACACAAACTATTGACGGATCAGGATCGGAAATCGACACCAAGACCTTGTCCAGGGGTGCCCGAATCAACCGCATATTCACTGAACGCCTACCCTACGCCCTAGCGATGCTTCACAATGATGGCGAAGAGTTGCGAAGGGACATTAGCTTTGCTATTCGCAACATTCATGGAATTCGCACTGGATTATTTACCCCCGACCTGGCCTTCGAGACAATCGTCCGTAAACAGATCGAACGCATGAAGGATCCCTCACTGACCTGTGTCGACCTGGTTGTCGAGGAGTTGAATCAAATAGTGCACGACTGTGCAAACAAGATGGAGTGCTTTCCACACCTTCGCGATGCAACCGAGCGTATTGTGACGGAGCGTATTAAGGAGAGGCAGGCGAACGCCCGCGACAAGATATGCCTCCTAGTGGATATTCAACTTGCCTACATCAACACCAATCACGAGGATTTCATCGGCTTTGCAAGCGCGGAACAGCAGTCATCTGATGTAAACAAAGTGAAACTGGGCAATCGAGTGATTCGACGGGGCTGGTTGGGTCTGCAAAATATCGCTCTCATACGTGGCGGCAGTAAGGACTTCTGGTTCGTCTTGAATGCGGAAACCCTCACCTGGTACAAAGACGACGATGAGAAGGAGAAACGCTACGTCCTGCTCCTGGACGGCCTGAAAGTCAAGGATGTTGAGTCGAGTTTCTTTGGCAAAAAGAACGTATTTGCGCTCTTCTATCCCGATGGAAGGAATGTGTACAAAGACTACAAGCAATTGGAGCTGAGTGCAGAGTCAGCTGAGATGGTCGACTCCTGGAAGGCCTCTTTCATGCGTGCTGGTGTTCAACCAATGAAACCCATCCAGCAGCAGCAACACCAAGAGCGATCAGATGAACAGCTTTCGGATAATGGTGACCCTCAGCTACAAAGGCAGGTAGAAGTTATCCACAATCTTGTCGATTCATACCTCAAGATTGTTCACAAGACTCAGCGCGATCTGGTGCCCAAAATGATCATGCATATAATTGTTAACGAGATGAAGGAGTTCCTGAAAAGCGAATTGCTACCAAATCTTTATCAGGCAGGAGACATTCAAGTTCTAATGTCGGAGTCCTTGGAGATGCAGACGCGACGTGAGGAGACCCTTCGAATGTACGAAGCATTGAAGGAAGCCTTACGTATAGTTGGTGAGGTGGCCACAAATACCGTCTCCACACCTGTCCCACCCCCCGTTATGGATGACTGGATGCACAACACTACCTCCCATTTAATTGACCCTGGCTCCTCGTCCTCAAGTCTCTTCCCTACAAGCACGGGTAGTGGTAGTGGCGGTGTAGGGATGATACAACCACCACGAAGTCCCGGAGGCACGCGGCGTCCCCCACCTCAACCCCCAGGCGCTCCCCACCGTCCCACGTCTTCGCCCCAACGACCTGGTTTTGTCGCTCCCCCTAGTGGTACTCTGCCATCGCCTCTCATTCCTCAGTTGAGTGCTCTGGGTCCCTCTGCGGTGGTGCCTAACGGTTTACCAAATGCTGGGATCAACAGTGGTGCTGTTGTCAGTAGCACTTGCCTTCAAAACGGTTCCTACAGTCCCCTTTTTCCGTCTCCATACCTGCCTCTCCAACCTCCGCTCCCTTTATTGCAACAGTTTTTTTCGATACGTGCAAACAATCCGGCCCCTCGTATTCCTGATCGACCCAACGCAGTTTCTCGTACTTGA

>LongOrf.asmbl_8877
MPGNAGMEQLIPLVNKLQDAFSSLGVPLNLDLPQIAVVGSQSAGKSSVLENFVGRDFLPRGSGIVTRRPLVLQLITSDAEYAEFLHLNGVKLTDFDEVRKEIEAETDRETGTNKGISNKPINLKIYSPNVLNLTLIDLPGMTKVPVGDQPSDISALIEEMILQYINCDYCLILAVSPANSDLANSDALKIAREVDPQGLRTIGVITKLDLMDHGTDARDVLENKLLPLRRGYIGVVNRSQKDIEGRKDITTAMAAERKFFLSHPAYRHMADRMGTPYLQRVLNQQLTNHIRETLPGLRNKLQSQMLAMEKEVREYKAYQPADPSFKTKALMIAVKSFEVEFTQTIDGSGSEIDTKTLSRGARINRIFTERLPYALAMLHNDGEELRRDISFAIRNIHGIRTGLFTPDLAFETIVRKQIERMKDPSLTCVDLVVEELNQIVHDCANKMECFPHLRDATERIVTERIKERQANARDKICLLVDIQLAYINTNHEDFIGFASAEQQSSDVNKVKLGNRVIRRGWLGLQNIALIRGGSKDFWFVLNAETLTWYKDDDEKEKRYVLLLDGLKVKDVESSFFGKKNVFALFYPDGRNVYKDYKQLELSAESAEMVDSWKASFMRAGVQPMKPIQQQQHQERSDEQLSDNGDPQLQRQVEVIHNLVDSYLKIVHKTQRDLVPKMIMHIIVNEMKEFLKSELLPNLYQAGDIQVLMSESLEMQTRREETLRMYEALKEALRIVGEVATNTVSTPVPPPVMDDWMHNTTSHLIDPGSSSSSLFPTSTGSGSGGVGMIQPPRSPGGTRRPPPQPPGAPHRPTSSPQRPGFVAPPSGTLPSPLIPQLSALGPSAVVPNGLPNAGINSGAVVSSTCLQNGSYSPLFPSPYLPLQPPLPLLQQFFSIRANNPAPRIPDRPNAVSRT*