Search results


Species: Taenia solium
Id: LongOrf.asmbl_435
Length: 2127
Strand: +
Start: 1520900
Stop: 1527617
Annotation: K01528 IPR022812|IPR003130|IPR001401|IPR019762|IPR000375 GO:0003924|GO:0005525 C4QFG1
Function: Dynamin|Dynamin GTPase effector|Dynamin, GTPase domain|Dynamin, GTPase region, conserved site|Dynamin central domain
Scaffold: Scaffold00001
Sequence:
>LongOrf.asmbl_435
ATGGAGACTCTTATTCCCGTCATTAATAAACTGCAGGATGTATTCAATACGGTTGGAAGCGAGGTTCTTCAGTTACCTCAGATCGTGGTAATCGGTAGCCAAAGTTCAGGAAAAAGTTCAGTACTGGAGAATATTGTTGGTCGGGACTTCCTTCCGAGGGGTTCTGGGATTGTCACTAGGAGACCATTGGTTTTGCAACTAATTCATGTAAATGAAGGAGAAGATGTAATTAGAAAGGAGGAAGGTGATGGCGTCTCCACTGAATGGGCCAAATTTCTTCACAAGAAGAATGAAGTATTTGTCGATTTTGACCTAGTCCGTGAGGAAATTGTGAAAGAGACTGCTCGTCTGGTTGGAAACGGGAAAATGGTGAGTTCGGAGGCGATACATCTGAAGATATATAGTCCGAGGGTTCTCAACCTGACGCTGGTTGATCTGCCAGGTATCACGAAGGTTCCAGTTGATGACCAACCGGAGGATATTGAGAATCAAATTAATACTTTGTGTCTGCATTACATCAGCAATCCTAACTGCATAATTCTTGCGGTCACTCCTGCTAATGCTGATATGGCCACCAGTGAATCGTTAAAACTCGCCAAGGAGGTTGACCCCGAAGGAAGACGTACACTTTGCGTCCTCACCAAGCTGGACCTGATGGATCACGGCACAGATGCCCATGACCTTTTGATGAATCGAGTTATTCCAGTGAAATTGGGGATTATCGGCGTGGTCAATCGTTCTCAAGCGGATATAAACGCGAAGAAATCTATCATTGATGCTCTAGCTTATGAGGCCTCCTTTCTACAACGCCGCTATCCCTCACTTGCAAGCAGAAATGGTACTGTCTACCTCACAAAGACTCTTAACCGGCTCCTGATGCACCACATTAGAGACTGTCTGCCCGAGTTGAAAACGCGTGTTAACGTGATGACGGCCCAATTCCAGACTCTCCTCAACTCCTTCGGTACTGAGGTGGAGGACAAAGGGCAGCTGTTGCTTCAAATAATCACGAGGTTCAACACGGCCTACTGCAATACTATCGACGGTGTTTCGAAAGACATCGAGACCTCCGAGTTGTGTGGAGGTGCCCGTATCTGTTATATCTTTCACGAAATCTTCTACAGCACTTTGGGTCGCATCGATCCCCTTGGGGGTCTCAATACTCTGGACATTCTCACCGCAATTCGAAATTCCACAGGTCCCAGACCTGCACTTTTTGTGCCCGAAGTCGCATTCGAATTGCTCGTGAAGAGGCAAATTCGTCGATTGGAAGAACCCAGTCTTCGGTGTGTGGAACTTGTTCACGAGGAGATGCAACGAATCATTCAGCACTGCGGAACCCAGCAAGAGATGTATCGGTTTCCAAACCTGCACGAGCGGATAGTGGACGTTGTCACGTCGTTGCTGCGACGTCGACTTCAGCCAACAAATGAGATGGTAACAAACCTTGTTGCCATCGAGTTAGCCTATATTAACACCCGTCACCCCGATTTCACGGAAGAACTCATGCTCCATCGACAGCAAGCGCCCCCGGGCCTCAATAACCTGGGCCTGGTTCGCATGAAGAGAGGGGCAGCTCAACTCCAGACTAGTGAGGTGGACCAAGAGTGGATCGAAGTTAGCTACAATACCTTGAGCGAGGCACCGTCGCAAGCACAGGCAGGCAGACGGGCTCAGCAGTCAGCGGCAGGACGGCGTCCAAACGCAGCGCCGGCGCAGCGACCTAATGACGCGCTCCAGGAGGCCGACTCATCCGACAGTGCTAATCTCTCGGGCTTTCACGCGACCCCTGACATTCAAACCCAGGTTCAACAGCATCAACTAACTGCTACGGAGAAGCGTGACTGTGATCTAATCAGCCAACTGATTCGCTCCTATTTCCAAATTGTGCGCAAGAACATCCTTGACTCGGTGCCGAAGGCGATCATGAACTTTCTGGTCAACTACGTGAAGGACAATTTGCAGTCGGAGTTGGTGAGCAATTTATACAAGAATGATGAGTACGACGGGTTGCTGAAAGAGAGCGAGAACGTGGCGCAACGGCGAAGGGAGGCGTCGGAGATGCTTAGGGGACTTCAACGAGCCAATCAGATCATCAGTGAAGTCCGGGAGGCCCCGATGTGGTAA

>LongOrf.asmbl_435
METLIPVINKLQDVFNTVGSEVLQLPQIVVIGSQSSGKSSVLENIVGRDFLPRGSGIVTRRPLVLQLIHVNEGEDVIRKEEGDGVSTEWAKFLHKKNEVFVDFDLVREEIVKETARLVGNGKMVSSEAIHLKIYSPRVLNLTLVDLPGITKVPVDDQPEDIENQINTLCLHYISNPNCIILAVTPANADMATSESLKLAKEVDPEGRRTLCVLTKLDLMDHGTDAHDLLMNRVIPVKLGIIGVVNRSQADINAKKSIIDALAYEASFLQRRYPSLASRNGTVYLTKTLNRLLMHHIRDCLPELKTRVNVMTAQFQTLLNSFGTEVEDKGQLLLQIITRFNTAYCNTIDGVSKDIETSELCGGARICYIFHEIFYSTLGRIDPLGGLNTLDILTAIRNSTGPRPALFVPEVAFELLVKRQIRRLEEPSLRCVELVHEEMQRIIQHCGTQQEMYRFPNLHERIVDVVTSLLRRRLQPTNEMVTNLVAIELAYINTRHPDFTEELMLHRQQAPPGLNNLGLVRMKRGAAQLQTSEVDQEWIEVSYNTLSEAPSQAQAGRRAQQSAAGRRPNAAPAQRPNDALQEADSSDSANLSGFHATPDIQTQVQQHQLTATEKRDCDLISQLIRSYFQIVRKNILDSVPKAIMNFLVNYVKDNLQSELVSNLYKNDEYDGLLKESENVAQRRREASEMLRGLQRANQIISEVREAPMW*