Search results


Species: Taenia solium
Id: LongOrf.asmbl_3186
Length: 1218
Strand: +
Start: 880208
Stop: 881756
Annotation: K04399 IPR002398|IPR015917|IPR011600|IPR011029|IPR016129|IPR017350|IPR001315 GO:0004197|GO:0006508|GO:0005515|GO:0005622|GO:0042981|GO:0006915|GO:0008234 C4Q5Z7
Function: Peptidase C14, caspase precursor p45|Peptidase C14, caspase precursor p45, core|Peptidase C14, caspase catalytic|DEATH-like|Peptidase C14, ICE, catalytic subunit p20, active site|Caspase, interleukin-1 beta convertase|Caspase Recruitment
Scaffold: Scaffold00007
Sequence:
>LongOrf.asmbl_3186
ATTTTAATTACTTGTGATTGGCCCTGGGGGTCTCACGTAGTCGGTTTCGGTGGGAGGTTCTCGCAGAGATGGTCTTCAGAAATGAATGCTGAACAAAGACAACGGCTGAGTCGGATGCAGGTTGATTTCGTGAAGGGACTGCGTGATATCGAGGAGATTACTGATTATCTCCTTTGTCATGAAATTCTTTCGCGGACTCAGGCTGAGAAAATCCTCTCCTCCGGTCCCGTAGTCGCCGACCAAGTTCGAACCCTCCTCAATGTGCTAGTCCGCTGTGGTCCCGACGCCTACGATACCTTCATATCCGCCCTTTCCGAAACTAATCAGTCTTCTTTTGCCGAAAAAATGGCCAATTTAAGCATGAGTCCCCGATCAGTGCATCCAGTCTCACCTCCCTCCAAGACGAAAGCTCATGTCACGGAGCACCCCACACAGCCGATTGCTGCATATCCCGTCAACTCCGCTCCCCACGGCTACATCCTCTTAGTAAACATCTCAAACTTCGAGGCGGGCTCGGGTCTCAGCAACCGAATTGGTTCATCAGAAGATGTCGTTGCTTTAAAATCTCTCTTCACCGACCTCGGTTACTTTGTTGAAGTACTTCTAGATCCCACCGCCACTGTCTTGGAGTCTAGTCTCAGTGCCTTTATAAAAAGTCCCAGTCACTATGAGGTTGACGCCGGTGGTCTCATTGTAATGTCCCACGGAGTGCAGGACTACATCTACACTGCCGACGGAAAACTCTTTGCCATTAATGACATCCTCGAAGCCTTTACCAACAAATCCTTCCCAGCCCTAGCCGGCAAACCCAAGTTTATCCTTTTTCAAGCTTGCAGAGGAGAGGAGAAGGATCGAGGATGCATATTCGAGCCCGATGATGCAAGCTTCATTGCATCCCCATTGGAAAGTGTGGACGCTGGGGTACACAAGACATTGTGGAAGTGTCTGCCCTATATGAGTGACTACATAATCGCCTACTCCACCCTGCCAGGCTTCGTGTCCTGGCGCTCGGAGAAGGCTGGGAGCTGGTTCATCCAAATTCTCGTCGATGTATTTCGCAAGTACGCCAGCTCTCTCCATGTGCTCGACCTGCTGACCGAAGTTAATCGCCGTCTGGTGGAGGAATCGCAGGAGCGTGAGTTTAAACAAATCACCCAGCAGTCCCACACCCTCACCCGTCCCTTCTACCTCGCTGGCACGCATTCTCAATCGAGGTGA

>LongOrf.asmbl_3186
ILITCDWPWGSHVVGFGGRFSQRWSSEMNAEQRQRLSRMQVDFVKGLRDIEEITDYLLCHEILSRTQAEKILSSGPVVADQVRTLLNVLVRCGPDAYDTFISALSETNQSSFAEKMANLSMSPRSVHPVSPPSKTKAHVTEHPTQPIAAYPVNSAPHGYILLVNISNFEAGSGLSNRIGSSEDVVALKSLFTDLGYFVEVLLDPTATVLESSLSAFIKSPSHYEVDAGGLIVMSHGVQDYIYTADGKLFAINDILEAFTNKSFPALAGKPKFILFQACRGEEKDRGCIFEPDDASFIASPLESVDAGVHKTLWKCLPYMSDYIIAYSTLPGFVSWRSEKAGSWFIQILVDVFRKYASSLHVLDLLTEVNRRLVEESQEREFKQITQQSHTLTRPFYLAGTHSQSR*