Search results


Species: Taenia solium
Id: LongOrf.asmbl_21683
Length: 1347
Strand: -
Start: 28083
Stop: 29709
Annotation: K12670 IPR005013 GO:0004579|GO:0005789|GO:0018279 Q5DFC1
Function: Oligosaccharyl transferase complex, subunit Wbp1
Scaffold: Scaffold00248
Sequence:
>LongOrf.asmbl_21683
TTTGTGTTACCGCCGCATTTGAGTGGTTGCATAAAGCTGATGAGGCTTTTTCTCCTGGTCGCCTTGTTGTTCTCAGCTAGGGCTGAGAACCAAGCTAGTGACAAAAATGTTTTGGTTCTTATAGAAAATATTGTCATCCGTGATACCCATTCTCAATTTTTCAAATCACTTACCGACCGGAATTACCAACTTACTTTTAAGTATGCTGATGACTCTACACTGGACTTAAAGCTGTTTGGCGAATATAATTACCAACATGTTGTCATTTTCGCTCCCACTACAAAAGAGTTTGGTGGCTACGTAAGTGTAAAAGCTTTGACTGATTTTGTTGATAATGGTGGAAACGTCCTCGTTGCTGGCGGTCCAGAACTCGGGGAAGCTGTTCGGGACTTTGCCAGTGAATGTGGAGTCGAATTTGATGCGTCCAACTCATCCGTTATTGACCACCATAATTTCGATGAGATGGATAATGGGGACCATACTCTGATCGTTGCAAGTCCTGAAGATGCTATAAATGTACCAGTTATCACCGGAGGATTTAAAAATCCCATTCTCTACCGTGGCGTGGGAATTTCCACAGATCCTACTAACCCTCTCATTATCACTGTTTTGCATGGGTCGGCTACGTCCTTCTCTTACGATGCGAAAAAAGTTGTTTCACAATATCCCACTACAGTTGGAAAGAACACTCAGCTTGTCGCGGCCCTGCAGGCCAGGAATGACGCTCGTGTCGTCTTCACCGGCTCAATCGAGATGTTTTCTGATGCATTTTACTCTTCTCCAGTCTTTAACAAGGTTACCAACAAGCGATTTGAACGCTCTAGCAACGCTGAGTTCTGTGATCACCTCTTGCAATGGACCTTCAAGGAGTCCGGTGTTCTTCGAGTTGCCAACGTCTCACATCACAGGGTCGGTGAGTCAACCGCCCGTCATGAGTACACAATAACGGACGACATCATCTACAAAATTGATATTGTGGAAAAAGACAAGAATGGGGTTTGGCGAGACTACGTGGCTGAGGATATTCAGTTGGAACTCGTCCGGATTGATCCATTCATACGTCGAAACCTCCAATTCAAAAATCACGGCTACGAGATGCGGATGAAGCTCCCCGACGTTTATGGCGTTTTCAAACTGGTTGTGGATTACCATCGAATTGGTTATACCTCCATTTTTAGTGCCACGCAGATCTCCGTCCGTCCATTCACGCACACGCAGTATGAGCGCTTCATCACGTCGGCCTATCCGTACTACGCAAGCGCTATCTCAATGATGCTGGGTGTCTTCCTCTTCTCCTTTGTATACCTCTATATAAGGGAAGGCAAGCCTAAGGCAAAGACGGACTGA

>LongOrf.asmbl_21683
FVLPPHLSGCIKLMRLFLLVALLFSARAENQASDKNVLVLIENIVIRDTHSQFFKSLTDRNYQLTFKYADDSTLDLKLFGEYNYQHVVIFAPTTKEFGGYVSVKALTDFVDNGGNVLVAGGPELGEAVRDFASECGVEFDASNSSVIDHHNFDEMDNGDHTLIVASPEDAINVPVITGGFKNPILYRGVGISTDPTNPLIITVLHGSATSFSYDAKKVVSQYPTTVGKNTQLVAALQARNDARVVFTGSIEMFSDAFYSSPVFNKVTNKRFERSSNAEFCDHLLQWTFKESGVLRVANVSHHRVGESTARHEYTITDDIIYKIDIVEKDKNGVWRDYVAEDIQLELVRIDPFIRRNLQFKNHGYEMRMKLPDVYGVFKLVVDYHRIGYTSIFSATQISVRPFTHTQYERFITSAYPYYASAISMMLGVFLFSFVYLYIREGKPKAKTD*