Search results


Species: Taenia solium
Id: LongOrf.asmbl_20917
Length: 4128
Strand: -
Start: 79272
Stop: 85609
Annotation: K06675 IPR010935|IPR003395 GO:0005515|GO:0005524|GO:0005694|GO:0051276 C1M0I8
Function: SMCs flexible hinge|RecF/RecN/SMC
Scaffold: Scaffold00214
Sequence:
>LongOrf.asmbl_20917
GAACATTGCTGGTTCTATAGTCAACAGATGGATCTGCCTGCAGAAGGTTCATGTCCGGTCACCATTAGCGATGACGATTTGCTCAATAACTGCCCCCCTGTCGAAATTCCGCCTCTCGAAGTTCCTTTCCATCTTTCCGACGAAAACAGTTCTCGTTTGGTACTTTCTCAAGTTGTTTGCGAGAATTTTAAGTCCTATGGTGGTCGCCGAGTACTTGGCCCTTTCCATAAGAACTTTACTTGTGTCATCGGCCCCAATGGTAGCGGAAAGAGCAACGTCATCGATGCCCTCCTTTTCGTTTTTGGTTTCCGTGCCTCCAAAGTTCGTTCGAAAAAACTCAGCAGTCTTATTCACAACAGCGATGAACTCCCTAATGTTAATTCCTGTCAAGTTTCCGTCTACTTTCAACGCATCATTGATACTGGTAGTCGAGCTAACGATTTTGAGGTTGTTCCCGGAAGCGAGTTTGTGGTCTCCCGCAAAGCCTTCAAGGACAATTCTAATTCATACTATGTCAACGACTGCAAGGCCAGTTTCAAAGAAGTCACACATCTTCTTCGTCAACATGGCATTGATCTCGATCATAATCGATTCCTGATTCTACAAGGGGAAGTCGAACAAATCTCTCTAATGAAACCCAAAGCCATAACTGAATATGAGACAGGTTTTCTGGAGTACTTGGAGGACATTATTGGCTCGAATAGGTTTAAACGTCCGCTGGCTATTTTGGCTGACCGTATTGAGCGGTTAAAGGACATTCGGTTGGAGAAATTAGCCCGTGTTAAAGCGGTAGAGAAGGAGAGGAATGAGTTGGAGACGGTAAAAGATGAGGCGGTAGCCTATTTGCGACTAATCAACAAAATGACGCGCATTAAGAATGTTATCTACCAGAAAAGACAGCATCAAGAACTTGCAAATGAGTCCCGTTCTCGCAAGGAACTCGTCATTGTGGAGCAGCAAGTTGAGGAATTCACCAAAGAGGTAAAAGACCTAGTAGAGGAGTTGCATAAGCTTAGATCCAAACGTGATGAGGACGAAAAACGAGCCTCCAGTCTCCAGGAGCAGCACAGAGCTGCAAAGGCTCGATTCGCAGGCTACGAGGCCGAGGACAGCCGACTGCGTGATGAGCACGCTCACCTCAAAGCACAGGGTAAACGAACCGTAAAAGCGTTAACAGCGGAGCGCAAGAAACTAGATGAGATCCGTCGCTTACCAGAAGAGGCGGAGGAGCGAAGAGAGACTCTGAAAGCGCAATTAGCTGAGTTGGAAGCAAATCGGGCGAAACAGGAGGCGATATATAAGGAGACGATGGAAATTCTGACACAGGAAACAGCCCCACTGCGAAAGAAGATGGAAGCAGCTGAAGCGGCTTTGGCACCGGTGCAGAAGGCGGCAGATAAAGCCGCTTCTAAGCTGGCAATCGCCCGACAAGAGCTAGATCTCGCGATGTCGGCGGTGAGACGGGAGGAAGAGAGGGCGAAGGGGGCGCGGGATGGTGCTCAATCGGCCCAGAATCGATTAGCGGAGCGGGAGCGACAGTTAGTGGACGCGAAGCGCAATGTAACGCCGCAACAGTTGAAGGAGCTGCAAAAAGTGAAGAGTGAGGTGGAGCAGGTCGGAGCTGAGGAGAAGCAACTAATCGAGCGGGTTAACCAACTTAGATCCTCTTTGGTGGAGGCTAAGTCCTCCTTCCAAAGTGACAATTCTCGGAATCGTGTCCTCACCGCTCTTTCCTCAGCAGTCCAGGAAGGGAAACTGGAGGGTGTTCTTGGGCGTTTAGGAGATTTGGGTGTGATTCCGCAGAAATATGATGTCGCGATATCCACTTCTTGTGGTGCGTTAGACCACATTGTTGTGGAGACTATGGAACTTGCTCAAAGAGCTGTTGAGTACTTGAAGAAGTACAACCTTGGACAGGCGTCTTTTATTGCTTTGGACAAGATGGAGCGCTGGACAATCGAAGCGGCTAAGCCATTTGTTGGCCCGGTGCCGTCGGCCCAACGGCTCTTCGATTTAGTGGATACTTCTATGAATCCGCGAGTAAAACCATGCTTCTACTTCGGCCTCCGCAACACCCTCATCGCGGATGACTTGGATGTGGCGGTGGACTGGGCGTTCAAGCATAAACAACGCTTTAGAGTCGTCACTCTCCGGGGCCAATTGATAGAGACATCGGGAGCTATGTCCGGCGGCGGCAGTGGACGTCCGATCTCTGGCCGCATGAACACAGACGCTCAGAAGGCGCGTCGTCGCAGCAGCGGCATTCCCCTTTGGACAGAGACATTCATTACAGAGAAGGAGGAGGAGCTTGCCGTTTGCGAGGTCCGTCTTACGGAGGCTCGGCAGCGTCGTGAACACCTTGAAGATACTGAGGCTCAGCTCTCGCAACGCATTCAGGAGGCTCAACGAGTTGTTACGAAATGTCAGAACGAAATAGAACGACTACGCGAGGAGGCAGAGGTGCTAGGACAGGAAGCAGAGCAGGCAGAAGTTCGTGCGGCACAAACGGGACCTTCGGTGGAGGAACGAGATAGGATGGAGGGATCGGTGGCTAATTTAGAGCGTCTTCATTTGAGCAAGGCGCAAAAGGCGGAAGAGTTACGTAGACGGGTGGATGAAGTTAAAACGGCTCTGGTGGATGCTGGGTCCGCGAGACTCGCCGCTGTTCGATCAAGGGTTGGACTGGTGGAGTCGAAGATTAAGGAGACCAATGATCTTTTCACGAAGCTGGAGGTGGACATTAAGTCGGCGCACCGCAACCAGGCAAAGTGCGAGGCGAAAGTAAAGGCCTACGAGGAAGAGGTGGAGACCCTTAAGGAGAAACTCACCGCTATCGAGGCTCGAATGGTGGAGATTGAAAAAGTCGCCAAGGTCTGTATGGAGGAGTTTCAGGAGCTCCAAAAGACGATCAAGGACCTGACTCAGGGCTTGTCGGCAATCGGTGAGGCAATTGAGAAGGTGGAGACCGCATTGGCTGCCAGTCGAAAGGCTGAGGGTGGAGCGCAGCGCAAGGCCGAGGAGCTCCGCTCTCAGGCCAAGGAAGCTGGAGGGCGGGCGAGAGGATGGCAAATGAAACTGCGCTCCCTCCGGCTTCACACCATCGAAGATGACGATGAAGACGAGGGGGAAGAGGCAATGGCGGAAGACGGTGCTGAAAGCGGCAGGCGTGGGAGCCAGTCGGTCGATAATGTGACACCCAGCTCCGTATCCTCGGGTCCCGCCGGTATTTCCTCCCCCTCAAGGGAGAGGAGGCTGAAGTTACCTGTGTATACGGAGGAACAACTGGCAGAAATGAAGGTGAACGAAGCGGAAGTGCACCGTTTAGAGGAGCAGACAGCAGCTATGGCACCAAACATGTCTGCCATCGAGCAATACCGTAAGAAGGTTGATCTCTACCTCAAACGTGTGGCCGAGTTGGATCAGGTCACTGAACTGCGATCTGAGCAGTTGCGCCAGGAGGCCGACGCCAGAGCTAAGCGCCTAAGTGAATTCATGAGTGGTTTTAACATCATTACAACGCGATTGAAGGAGATGTACCAGATGCTCACTCAGGGGGGAGATGCAGAGCTGGAGTTGATAGACTCACTGGACCCCTTCTCCGAGGGCATCGTTTTCAGTGTCCGCCCGCCAAAAAAGACATGGAAGAGTATCGCAAATTTGTCTGGAGGAGAAAAAACCCTTTCATCCTTAGCCCTGGTATTCGCTCTTCATCACTATAAGCCCACACCACTCTATGTGATGGATGAGATAGACGCGGCTTTGGATTTCAAGAACGTCTCGATTGTGGGCAACTATGTAGTGGAGAGGACAAAGAACGCACAATTTGTGATTATTTCGTTGAGAAATAACATGTTTGAGCTAGCGGACAGGTTGGTGGGGATTTATAAGACCCACAATATTACCAAATCGATTGCGCTGGATTGTGCTAGCCTGTCAAAGCGATTGGAAGTTGTGGTAGCTGCGAGGTTGGGAGCGAGGACGCAGAGCAATCCTGACAATCAATGTGTCCCACCTAAGCAGGCGGAGGCCAACCGATTAGTGACAGCAATGGAGACGACCGAAGTGGAGCAAGCAAGAAGCAATTGCAGTACCGATTCTGCACAGACATTTATTCCTCAGGTGAATTGA

>LongOrf.asmbl_20917
EHCWFYSQQMDLPAEGSCPVTISDDDLLNNCPPVEIPPLEVPFHLSDENSSRLVLSQVVCENFKSYGGRRVLGPFHKNFTCVIGPNGSGKSNVIDALLFVFGFRASKVRSKKLSSLIHNSDELPNVNSCQVSVYFQRIIDTGSRANDFEVVPGSEFVVSRKAFKDNSNSYYVNDCKASFKEVTHLLRQHGIDLDHNRFLILQGEVEQISLMKPKAITEYETGFLEYLEDIIGSNRFKRPLAILADRIERLKDIRLEKLARVKAVEKERNELETVKDEAVAYLRLINKMTRIKNVIYQKRQHQELANESRSRKELVIVEQQVEEFTKEVKDLVEELHKLRSKRDEDEKRASSLQEQHRAAKARFAGYEAEDSRLRDEHAHLKAQGKRTVKALTAERKKLDEIRRLPEEAEERRETLKAQLAELEANRAKQEAIYKETMEILTQETAPLRKKMEAAEAALAPVQKAADKAASKLAIARQELDLAMSAVRREEERAKGARDGAQSAQNRLAERERQLVDAKRNVTPQQLKELQKVKSEVEQVGAEEKQLIERVNQLRSSLVEAKSSFQSDNSRNRVLTALSSAVQEGKLEGVLGRLGDLGVIPQKYDVAISTSCGALDHIVVETMELAQRAVEYLKKYNLGQASFIALDKMERWTIEAAKPFVGPVPSAQRLFDLVDTSMNPRVKPCFYFGLRNTLIADDLDVAVDWAFKHKQRFRVVTLRGQLIETSGAMSGGGSGRPISGRMNTDAQKARRRSSGIPLWTETFITEKEEELAVCEVRLTEARQRREHLEDTEAQLSQRIQEAQRVVTKCQNEIERLREEAEVLGQEAEQAEVRAAQTGPSVEERDRMEGSVANLERLHLSKAQKAEELRRRVDEVKTALVDAGSARLAAVRSRVGLVESKIKETNDLFTKLEVDIKSAHRNQAKCEAKVKAYEEEVETLKEKLTAIEARMVEIEKVAKVCMEEFQELQKTIKDLTQGLSAIGEAIEKVETALAASRKAEGGAQRKAEELRSQAKEAGGRARGWQMKLRSLRLHTIEDDDEDEGEEAMAEDGAESGRRGSQSVDNVTPSSVSSGPAGISSPSRERRLKLPVYTEEQLAEMKVNEAEVHRLEEQTAAMAPNMSAIEQYRKKVDLYLKRVAELDQVTELRSEQLRQEADARAKRLSEFMSGFNIITTRLKEMYQMLTQGGDAELELIDSLDPFSEGIVFSVRPPKKTWKSIANLSGGEKTLSSLALVFALHHYKPTPLYVMDEIDAALDFKNVSIVGNYVVERTKNAQFVIISLRNNMFELADRLVGIYKTHNITKSIALDCASLSKRLEVVVAARLGARTQSNPDNQCVPPKQAEANRLVTAMETTEVEQARSNCSTDSAQTFIPQVN*