Search results


Species: Taenia solium
Id: LongOrf.asmbl_16811
Length: 1713
Strand: -
Start: 181583
Stop: 184958
Annotation: K09047 IPR004827|IPR000837|IPR011616 GO:0003700|GO:0006355|GO:0043565|GO:0003677|GO:0005634|GO:0046983 C4PYA7
Function: Basic-leucine zipper (bZIP) transcription factor|Fos transforming protein|bZIP transcription factor, bZIP-1
Scaffold: Scaffold00122
Sequence:
>LongOrf.asmbl_16811
ATGATGTCGTCAGTGGCCAACAACCACGGTCCCTTCGGTCAACAATCTCTCATTCCTCCGGAGAAGCCGTCGCCTTCAAGTGCTATCCCGATGACATTCTACAAGCGCGATTCTGGAGGCACCACCAACCCTGATTGCTACCCCATGGATGCCTCATCTATGCGTCCGCGCCAACCTGATTACACGGGCTGGTCCCCTCTTCCTAATATCAGCTCCCCTCAATGGACTGAGGTCTCCTGTGAATCTACCACGCCTCATGTTGGAAGCCTTCCAGCTGCACACAGCCTGCTGTCCCATCCTCCAAAAAGCAGCGTTCCTACCACCTCCACAACAGTGATGACGAACCAAAATGGAAAGACATTTACGGCACCTACTTCCACTACGACTCCAGTAGGGGCATATCCACGATATGAGGAACAACATCAGCATTACTCTCCAACTTATCCTCTCAAACGAGGATCCTCTTATAGCGGTCCCAGACCCGCATATCTAAACAGTTCAGCAACCGGTGTAATGCCACATATGGAATACGCAGACGGCCAAGGGGACCTCTACCACGCCAAATCTAACCCGGCTTTTCAGCCTCTTAGTTCGGATTTGCAGTACAACGCCTACAGATATGGGAACGCTCGGGACGAAAAAACCCAGCTCTCCGTAAATGGACTAGCGATGCGAGCAGCGAAGATGCCTGGACGGTTTCAGCCTACTGATTCAATGGCCATTTCACCACCTGCTAGTCTTGCTTCGTCTGACGGGGAGACAACGGCCAGTTCTTCGGCCACCAGGGGGGCGAGCTCACTCCCATCGACAGGTGCGGTCTCCACTACAACGACAGCGGTAGTTGCGGCGGCTTCAGTGGTGTCGCAACCCAAACGACCTCGAAAACCTGCTCCCACACTGGCCACTGGACGTCGGAATCTCAAATCAGAACCGGTTGACCCCGATGAGGCGGATAGAAGAATGAAACGACGAGAGAGGAATCGCAAATCGGCTCAAAAGTGCCGTGAACGCAAGCTCCATCGAACGCAGGAATTGCAGGCCCAAGTAGAGAATCTCAACATGGAGACCACTCGTTTGTTGCGTGAAATGGAGGTGTGGCGCGATTACTGTCGTAAGTGTGTTGCCCTCCTACACCAGCACTGTCCTGGTGTCTCGATTCCCGTACTTAACTGCGTGGTGGAGAATTCGGAGAGTTACTTGCCACCGGCGCCTGCTGACAGTGTCACCCCAATGGATGCAGAACCATTGCCCTTCTGTGATGTGGTGGACCAACCCGATGTGAGCTTCTATAACAAGACGCCAGGGCGCGAGGGGTATGGTGGATTAAGCGGTACCAATAACAACAACATCACCACCTCAGTAGCAGCTGCTACTGGTTCCAACGCTGGCCCGTGGAATGGACGGGCTTTCTCTCAAGTCACTCCCCAATTACCACCACTTTCTCAGTTCGTACCGATCTCATCACAGATGTCCACTGCTTCATCGTCCGGAACGCCTGTGACGATGAAGTCGGAGCCGAGGTTGAGTAATTTTTGGAAGGGGGATGAGGCAATAGAACCCTTTCTTGCCGAAGTGAATCATGAGGGTAGGGACTCAGAATGGAAGACGGAAAATGACACGGACTCCTCGTCAGGCTGTGGAGTTCCACCCCGCTTGAATACCCCCAACACTAACGAGGCGGATAAGACGAGTACACTAAGCTCGTCACTGTAG

>LongOrf.asmbl_16811
MMSSVANNHGPFGQQSLIPPEKPSPSSAIPMTFYKRDSGGTTNPDCYPMDASSMRPRQPDYTGWSPLPNISSPQWTEVSCESTTPHVGSLPAAHSLLSHPPKSSVPTTSTTVMTNQNGKTFTAPTSTTTPVGAYPRYEEQHQHYSPTYPLKRGSSYSGPRPAYLNSSATGVMPHMEYADGQGDLYHAKSNPAFQPLSSDLQYNAYRYGNARDEKTQLSVNGLAMRAAKMPGRFQPTDSMAISPPASLASSDGETTASSSATRGASSLPSTGAVSTTTTAVVAAASVVSQPKRPRKPAPTLATGRRNLKSEPVDPDEADRRMKRRERNRKSAQKCRERKLHRTQELQAQVENLNMETTRLLREMEVWRDYCRKCVALLHQHCPGVSIPVLNCVVENSESYLPPAPADSVTPMDAEPLPFCDVVDQPDVSFYNKTPGREGYGGLSGTNNNNITTSVAAATGSNAGPWNGRAFSQVTPQLPPLSQFVPISSQMSTASSSGTPVTMKSEPRLSNFWKGDEAIEPFLAEVNHEGRDSEWKTENDTDSSSGCGVPPRLNTPNTNEADKTSTLSSSL*